Rmu_sc0000536.1_g000015

Cell division cycle-associated 7-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000536.1
OG0001920
Physical Location & Seq
Reverse (-)
72203 .. 75171
2969 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1218 bp
atggtgagccgaagaacccgaggtcccaaacccgccgccgacggcgacgatgaaaccggaagcggagacaacgcagccgcagaggtttcggactacgagcaaatcagagaccaacggatcaaagagaacaaggagcggatgcagaagctgggcattttcgacctttcactccagctcaagtccaaaccctccgccgcttcaaaacgcggccgtccgttgaaggacccttccgatcagaccaaaatcataaccaaaacctctctctccccagcaaggcgttcctctaggttgaagactctggctccggtgagttatgtggagattaggcccaaagggaagagggagtcttcgtggaatggtgagattaatatcaaggagggtataaggccagagatttatagtgatgagcatgaaaagctattgggggattgtaaggagacttgggaactctcggttgatgggtatggagaagacgggaagcggatttatgatccggttaagggtgaaacttgccaccaatgcaggtggctcatatggggtgaaccaaatggtgagattaatatcaaggagggtataaggccagagatttatagtgatgagcatgaaaagctattgggggattgtaaggagacttgggaactctcggttgatgggtatggagaagacgggaagcggatttatgatccggttaagggtgaaacttgccaccaatgcaggcagaaaactcttggtcagcatacacattgctgcaaatgtgacttggtccaagggcagttttgtggagattgcttatacatgagatatggagagaatgtgatcgaagccagcaaaaatcctgattgggtttgccctgtttgtcggggcatttgcaactgcagtctttgccgtaaagaaaaagggtgggagcccactggtaatctgtataggaaggtcataaatctgggttacaagtctgtggcacattatcttattcaaacccgtcgttcccaacgaaaatcagaaacctcaggtgcagaggaatcaatgcatgatgatatgaaacaagaaacagaagaggcacacttaacagggggagaagaaatggaagaggttcagtgtgttgatgccaaagagttgggtaacatagatgatactggtgctgccgttgctggggattcagttgaaggtgagacaaagggaaagctgagaaggaggagcacaaggttgaggaagaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-4CXXC_R1

Protein Analysis

405

Amino Acids

45.75

Weight (kDa)

6.22

Isoelectric Point (pI)

45.1

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-4CXXC_R1 PF10497 227 - 323 7.9e-40 Zinc-finger domain of monoamine-oxidase A repressor R1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 513
Acc36I ACCTGC 1 cut(s) 513
AccBSI CCGCTC 1 cut(s) 136
AccII CGCG 1 cut(s) 207
AclWI GGATC 3 cut(s) 125, 485, 677
AcoI YGGCCR 1 cut(s) 208
AfiI CCNNNNNNNGG 4 cut(s) 273, 500, 692, 1149
AgsI TTSAA 5 cut(s) 201, 220, 292, 974, 1163
AloI GAACNNNNNNTCC 2 cut(s) 7, 39
AluBI AGCT 5 cut(s) 148, 175, 418, 610, 1183
AluI AGCT 5 cut(s) 148, 175, 418, 610, 1183
Alw21I GWGCWC 1 cut(s) 1199
Alw26I GTCTC 5 cut(s) 60, 102, 431, 623, 1163
AlwI GGATC 3 cut(s) 125, 485, 677
AlwNI CAGNNNCTG 1 cut(s) 148
Ama87I CYCGRG 1 cut(s) 18
AoxI GGCC 4 cut(s) 208, 326, 386, 578
ApeKI GCWGC 3 cut(s) 74, 747, 1139
AseI ATTAAT 2 cut(s) 366, 558
Asp700I GAANNNNTTC 1 cut(s) 1089
AspS9I GGNCC 4 cut(s) 23, 223, 327, 763
AsuHPI GGTGA 8 cut(s) 16, 319, 371, 515, 551, 563, 707, 1178
AvaI CYCGRG 1 cut(s) 18
AvaII GGWCC 3 cut(s) 23, 223, 763
AxyI CCTNAGG 1 cut(s) 1006
BanII GRGCYC 1 cut(s) 909
BbsI GAAGAC 4 cut(s) 299, 339, 477, 669
Bbv12I GWGCWC 1 cut(s) 1199
BbvI GCAGC 3 cut(s) 86, 734, 1126
BccI CCATC 2 cut(s) 452, 644
BceAI ACGGC 4 cut(s) 58, 195, 870, 1127
BcgI CGANNNNNNTGC 2 cut(s) 69, 103
BcoDI GTCTC 5 cut(s) 60, 102, 431, 623, 1163
BfaI CTAG 1 cut(s) 285
BfmI CTRYAG 1 cut(s) 874
BfuAI ACCTGC 1 cut(s) 513
BisI GCNGC 7 cut(s) 36, 75, 78, 195, 208, 748, 1140
BlsI GCNGC 7 cut(s) 37, 76, 79, 196, 209, 749, 1141
Bme18I GGWCC 3 cut(s) 23, 223, 763
BmeT110I CYCGRG 1 cut(s) 18
BmgT120I GGNCC 4 cut(s) 23, 223, 327, 763
BmiI GGNNCC 4 cut(s) 25, 225, 303, 906
BmsI GCATC 2 cut(s) 129, 1093
BpiI GAAGAC 4 cut(s) 299, 339, 477, 669
BpmI CTGGAG 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 161
BsaBI GATNNNNATC 2 cut(s) 368, 560
BsaI GGTCTC 1 cut(s) 102
BsaJI CCNNGG 2 cut(s) 19, 766
BsaWI WCCGGW 4 cut(s) 56, 304, 493, 685
BsaXI ACNNNNNCTCC 6 cut(s) 286, 316, 335, 365, 798, 828
Bsc4I CCNNNNNNNGG 4 cut(s) 273, 500, 692, 1149
Bse1I ACTGG 2 cut(s) 916, 1138
Bse21I CCTNAGG 1 cut(s) 1006
Bse3DI GCAATG 1 cut(s) 742
Bse8I GATNNNNATC 2 cut(s) 368, 560
BseDI CCNNGG 2 cut(s) 19, 766
BseGI GGATG 1 cut(s) 144
BseJI GATNNNNATC 2 cut(s) 368, 560
BseLI CCNNNNNNNGG 4 cut(s) 273, 500, 692, 1149
BseMI GCAATG 1 cut(s) 742
BseMII CTCAG 2 cut(s) 1020, 1175
BseNI ACTGG 2 cut(s) 916, 1138
BseRI GAGGAG 1 cut(s) 1207
BseX3I CGGCCG 1 cut(s) 208
BseXI GCAGC 3 cut(s) 86, 734, 1126
BseYI CCCAGC 3 cut(s) 148, 268, 1148
BsgI GTGCAG 1 cut(s) 1032
Bsh1236I CGCG 1 cut(s) 207
Bsh1285I CGRYCG 1 cut(s) 211
BshFI GGCC 4 cut(s) 210, 328, 388, 580
BsiEI CGRYCG 1 cut(s) 211
BsiHKAI GWGCWC 1 cut(s) 1199
BsiHKCI CYCGRG 1 cut(s) 18
BsiSI CCGG 4 cut(s) 57, 305, 494, 686
BslFI GGGAC 1 cut(s) 9
BslI CCNNNNNNNGG 4 cut(s) 273, 500, 692, 1149
BsmAI GTCTC 5 cut(s) 60, 102, 431, 623, 1163
BsmFI GGGAC 1 cut(s) 9
BsnI GGCC 4 cut(s) 210, 328, 388, 580
Bso31I GGTCTC 1 cut(s) 102
BsoBI CYCGRG 1 cut(s) 18
Bsp1286I GDGCHC 2 cut(s) 909, 1199
Bsp143I GATC 5 cut(s) 117, 232, 490, 682, 816
BspANI GGCC 4 cut(s) 210, 328, 388, 580
BspCNI CTCAG 2 cut(s) 1019, 1176
BspFNI CGCG 1 cut(s) 207
BspLI GGNNCC 4 cut(s) 25, 225, 303, 906
BspMAI CTGCAG 1 cut(s) 878
BspMI ACCTGC 1 cut(s) 513
BspPI GGATC 3 cut(s) 125, 485, 677
BspTNI GGTCTC 1 cut(s) 102
BsrBI CCGCTC 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 742
BsrI ACTGG 2 cut(s) 916, 1138
BssECI CCNNGG 2 cut(s) 19, 766
BssMI GATC 5 cut(s) 117, 232, 490, 682, 816
BssT1I CCWWGG 1 cut(s) 766
Bst6I CTCTTC 3 cut(s) 332, 1047, 1080
BstAPI GCANNNNNTGC 1 cut(s) 882
BstC8I GCNNGC 2 cut(s) 716, 826
BstDEI CTNAG 2 cut(s) 1006, 1184
BstF5I GGATG 1 cut(s) 144
BstFNI CGCG 1 cut(s) 207
BstKTI GATC 5 cut(s) 120, 235, 493, 685, 819
BstMAI GTCTC 5 cut(s) 60, 102, 431, 623, 1163
BstMBI GATC 5 cut(s) 117, 232, 490, 682, 816
BstMCI CGRYCG 1 cut(s) 211
BstMWI GCNNNNNNNGC 6 cut(s) 415, 519, 607, 711, 882, 1145
BstSFI CTRYAG 1 cut(s) 874
BstUI CGCG 1 cut(s) 207
BstV1I GCAGC 3 cut(s) 86, 734, 1126
BstV2I GAAGAC 4 cut(s) 299, 339, 477, 669
BstXI CCANNNNNNTGG 1 cut(s) 1114
BstZI CGGCCG 1 cut(s) 208
Bsu36I CCTNAGG 1 cut(s) 1006
BsuRI GGCC 4 cut(s) 210, 328, 388, 580
BtsCI GGATG 1 cut(s) 144
BtsIMutI CAGTG 2 cut(s) 909, 1100
BveI ACCTGC 1 cut(s) 513
Cac8I GCNNGC 2 cut(s) 716, 826
CaiI CAGNNNCTG 1 cut(s) 148
Cfr13I GGNCC 4 cut(s) 23, 223, 327, 763
CspCI CAANNNNNGTGG 2 cut(s) 506, 541
CviAII CATG 4 cut(s) 410, 602, 796, 1028
DdeI CTNAG 2 cut(s) 1006, 1184
DpnI GATC 5 cut(s) 119, 234, 492, 684, 818
DpnII GATC 5 cut(s) 117, 232, 490, 682, 816
EaeI YGGCCR 1 cut(s) 208
EagI CGGCCG 1 cut(s) 208
Eam1104I CTCTTC 3 cut(s) 332, 1047, 1080
EarI CTCTTC 3 cut(s) 332, 1047, 1080
EciI GGCGGA 1 cut(s) 181
EclXI CGGCCG 1 cut(s) 208
Eco130I CCWWGG 1 cut(s) 766
Eco24I GRGCYC 1 cut(s) 909
Eco31I GGTCTC 1 cut(s) 102
Eco47I GGWCC 3 cut(s) 23, 223, 763
Eco52I CGGCCG 1 cut(s) 208
Eco81I CCTNAGG 1 cut(s) 1006
Eco88I CYCGRG 1 cut(s) 18
EcoO109I RGGNCCY 2 cut(s) 23, 223
EcoT14I CCWWGG 1 cut(s) 766
EcoT22I ATGCAT 1 cut(s) 1029
EcoT38I GRGCYC 1 cut(s) 909
ErhI CCWWGG 1 cut(s) 766
FaeI CATG 4 cut(s) 413, 605, 799, 1031
FaqI GGGAC 1 cut(s) 9
FatI CATG 4 cut(s) 409, 601, 795, 1027
FauI CCCGC 1 cut(s) 40
FauNDI CATATG 1 cut(s) 533
Fnu4HI GCNGC 7 cut(s) 36, 75, 78, 195, 208, 748, 1140
FokI GGATG 1 cut(s) 151
FriOI GRGCYC 1 cut(s) 909
Fsp4HI GCNGC 7 cut(s) 36, 75, 78, 195, 208, 748, 1140
FspBI CTAG 1 cut(s) 285
GluI GCNGC 7 cut(s) 36, 75, 78, 195, 208, 748, 1140
GsaI CCCAGC 3 cut(s) 152, 272, 1152
GsuI CTGGAG 1 cut(s) 155
HaeIII GGCC 4 cut(s) 210, 328, 388, 580
HapII CCGG 4 cut(s) 57, 305, 494, 686
Hin1II CATG 4 cut(s) 413, 605, 799, 1031
HinfI GANTC 4 cut(s) 295, 344, 1019, 1154
HpaII CCGG 4 cut(s) 57, 305, 494, 686
HphI GGTGA 8 cut(s) 16, 319, 371, 515, 551, 563, 707, 1178
Hpy166II GTNNAC 1 cut(s) 542
Hpy188I TCNGA 5 cut(s) 91, 107, 232, 237, 1000
Hpy188III TCNNGA 1 cut(s) 836
Hpy8I GTNNAC 1 cut(s) 542
Hpy99I CGWCG 3 cut(s) 44, 50, 984
HpyAV CCTTC 5 cut(s) 214, 237, 922, 1157, 1182
HpyCH4V TGCA 8 cut(s) 142, 522, 714, 750, 870, 876, 1013, 1027
HpyF10VI GCNNNNNNNGC 6 cut(s) 415, 519, 607, 711, 882, 1145
HpyF3I CTNAG 2 cut(s) 1006, 1184
Hsp92II CATG 4 cut(s) 413, 605, 799, 1031
Kzo9I GATC 5 cut(s) 117, 232, 490, 682, 816
LmnI GCTCC 4 cut(s) 133, 307, 904, 1194
Lsp1109I GCAGC 3 cut(s) 86, 734, 1126
LweI GCATC 2 cut(s) 129, 1093
MaeI CTAG 1 cut(s) 285
MaeIII GTNAC 3 cut(s) 755, 944, 1118
MalI GATC 5 cut(s) 119, 234, 492, 684, 818
MbiI CCGCTC 1 cut(s) 136
MboI GATC 5 cut(s) 117, 232, 490, 682, 816
MboII GAAGA 9 cut(s) 24, 304, 339, 349, 482, 674, 1064, 1088, 1097
MhlI GDGCHC 2 cut(s) 909, 1199
MlyI GAGTC 2 cut(s) 289, 353
Mph1103I ATGCAT 1 cut(s) 1029
MroXI GAANNNNTTC 1 cut(s) 1089
MseI TTAA 5 cut(s) 366, 498, 558, 690, 1064
MspI CCGG 4 cut(s) 57, 305, 494, 686
MvnI CGCG 1 cut(s) 207
MwoI GCNNNNNNNGC 6 cut(s) 415, 519, 607, 711, 882, 1145
NdeI CATATG 1 cut(s) 533
NdeII GATC 5 cut(s) 117, 232, 490, 682, 816
NlaIII CATG 4 cut(s) 413, 605, 799, 1031
NlaIV GGNNCC 4 cut(s) 25, 225, 303, 906
NmuCI GTSAC 1 cut(s) 755
NsiI ATGCAT 1 cut(s) 1029
PaqCI CACCTGC 1 cut(s) 513
PcsI WCGNNNNNNNCGW 1 cut(s) 988
PdmI GAANNNNTTC 1 cut(s) 1089
PfeI GAWTC 2 cut(s) 1019, 1154
PflFI GACNNNGTC 1 cut(s) 761
PkrI GCNGC 7 cut(s) 37, 76, 79, 196, 209, 749, 1141
PleI GAGTC 2 cut(s) 289, 352
PpsI GAGTC 2 cut(s) 289, 352
PpuMI RGGWCCY 2 cut(s) 23, 223
PshBI ATTAAT 2 cut(s) 366, 558
Psp5II RGGWCCY 2 cut(s) 23, 223
PspFI CCCAGC 3 cut(s) 148, 268, 1148
PspN4I GGNNCC 4 cut(s) 25, 225, 303, 906
PspPI GGNCC 4 cut(s) 23, 223, 327, 763
PspPPI RGGWCCY 2 cut(s) 23, 223
PstI CTGCAG 1 cut(s) 878
PstNI CAGNNNCTG 1 cut(s) 148
PsyI GACNNNGTC 1 cut(s) 761
SaqAI TTAA 5 cut(s) 366, 498, 558, 690, 1064
SatI GCNGC 7 cut(s) 36, 75, 78, 195, 208, 748, 1140
Sau3AI GATC 5 cut(s) 117, 232, 490, 682, 816
Sau96I GGNCC 4 cut(s) 23, 223, 327, 763
SchI GAGTC 2 cut(s) 289, 353
SduI GDGCHC 2 cut(s) 909, 1199
SfaNI GCATC 2 cut(s) 129, 1093
SfcI CTRYAG 1 cut(s) 874
SinI GGWCC 3 cut(s) 23, 223, 763
SmlI CTYRAG 1 cut(s) 176
SmoI CTYRAG 1 cut(s) 176
SspMI CTAG 1 cut(s) 285
StyI CCWWGG 1 cut(s) 766
TaqI TCGA 2 cut(s) 159, 819
TauI GCSGC 4 cut(s) 38, 80, 197, 210
TfiI GAWTC 2 cut(s) 1019, 1154
Tru1I TTAA 5 cut(s) 366, 498, 558, 690, 1064
Tru9I TTAA 5 cut(s) 366, 498, 558, 690, 1064
TscAI CASTG 2 cut(s) 916, 1100
TseFI GTSAC 1 cut(s) 755
TseI GCWGC 3 cut(s) 74, 747, 1139
Tsp45I GTSAC 1 cut(s) 755
TspDTI ATGAA 4 cut(s) 66, 426, 618, 1052
TspGWI ACGGA 2 cut(s) 130, 204
TspRI CASTG 2 cut(s) 916, 1100
Tth111I GACNNNGTC 1 cut(s) 761
VpaK11BI GGWCC 3 cut(s) 23, 223, 763
VspI ATTAAT 2 cut(s) 366, 558
XmnI GAANNNNTTC 1 cut(s) 1089
XspI CTAG 1 cut(s) 285
Zsp2I ATGCAT 1 cut(s) 1029
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.