Rmu_sc0000546.1_g000046

Common central domain of tyrosinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000546.1
OG0000836
Physical Location & Seq
Reverse (-)
199281 .. 199634
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000546.1_g000046.1.cds

Sequence Viewer

Length: 354 bp
atgggagcattttattatgcagctagggaacctagtttatatgcacaacactctaatgtggaccgactttgggaggtttggaagcaaattcataaggttggtttgcaaacatttgatcttgattggctcaactctagtttgtatttccatgatgagaattcacagcttgtgagaatcaaagttcgtgatgttttggatactaaaaagctgaggtatgtttatgaggaggttgatcttccatggctaaatagacgtccaaagcctaactctattccatccaaaattgccaaccatgcagtgaaaataagagaaaacataaccatttttcctgcagagttaggaccatgtggttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00350 ko00950 ko01100 ko01110 map00350 map00950 map01100 map01110
Pfam Domains
Protein Families
PPO1_DWL PPO1_KFDV Tyrosinase

Protein Analysis

117

Amino Acids

13.77

Weight (kDa)

8.71

Isoelectric Point (pI)

45.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 256
AcsI RAATTY 2 cut(s) 87, 157
AcyI GRCGYC 1 cut(s) 253
AfiI CCNNNNNNNGG 1 cut(s) 70
AluBI AGCT 3 cut(s) 23, 166, 208
AluI AGCT 3 cut(s) 23, 166, 208
ApeKI GCWGC 1 cut(s) 20
ApoI RAATTY 2 cut(s) 87, 157
AspS9I GGNCC 2 cut(s) 61, 341
AvaII GGWCC 2 cut(s) 61, 341
BbvCI CCTCAGC 1 cut(s) 209
BbvI GCAGC 1 cut(s) 32
BccI CCATC 1 cut(s) 283
BciVI GTATCC 1 cut(s) 190
BfaI CTAG 3 cut(s) 24, 33, 135
BfmI CTRYAG 1 cut(s) 330
BfuI GTATCC 1 cut(s) 190
BisI GCNGC 1 cut(s) 21
BlsI GCNGC 1 cut(s) 22
Bme18I GGWCC 2 cut(s) 61, 341
BmgT120I GGNCC 2 cut(s) 61, 341
BmiI GGNNCC 1 cut(s) 30
Bpu10I CCTNAGC 1 cut(s) 209
BsaHI GRCGYC 1 cut(s) 253
BsaJI CCNNGG 1 cut(s) 239
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 239
BseGI GGATG 1 cut(s) 275
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 200
BseRI GAGGAG 1 cut(s) 239
BseXI GCAGC 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 70
Bsp143I GATC 2 cut(s) 115, 232
Bsp19I CCATGG 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 201
BspLI GGNNCC 1 cut(s) 30
BspMAI CTGCAG 1 cut(s) 334
BssECI CCNNGG 1 cut(s) 239
BssMI GATC 2 cut(s) 115, 232
BssNI GRCGYC 1 cut(s) 253
BssT1I CCWWGG 1 cut(s) 239
BstACI GRCGYC 1 cut(s) 253
BstDEI CTNAG 1 cut(s) 209
BstDSI CCRYGG 1 cut(s) 239
BstF5I GGATG 1 cut(s) 275
BstKTI GATC 2 cut(s) 118, 235
BstMBI GATC 2 cut(s) 115, 232
BstMWI GCNNNNNNNGC 1 cut(s) 293
BstSFI CTRYAG 1 cut(s) 330
BstV1I GCAGC 1 cut(s) 32
BsuI GTATCC 1 cut(s) 190
BtgI CCRYGG 1 cut(s) 239
BtsCI GGATG 1 cut(s) 275
BtsI GCAGTG 1 cut(s) 303
BtsIMutI CAGTG 1 cut(s) 303
Cfr13I GGNCC 2 cut(s) 61, 341
CviAII CATG 4 cut(s) 149, 240, 293, 345
CviJI RGCY 6 cut(s) 23, 127, 166, 208, 244, 262
CviKI_1 RGCY 6 cut(s) 23, 127, 166, 208, 244, 262
DdeI CTNAG 1 cut(s) 209
DpnI GATC 2 cut(s) 117, 234
DpnII GATC 2 cut(s) 115, 232
Eco130I CCWWGG 1 cut(s) 239
Eco47I GGWCC 2 cut(s) 61, 341
EcoRI GAATTC 1 cut(s) 157
EcoT14I CCWWGG 1 cut(s) 239
ErhI CCWWGG 1 cut(s) 239
FaeI CATG 4 cut(s) 152, 243, 296, 348
FatI CATG 4 cut(s) 148, 239, 292, 344
Fnu4HI GCNGC 1 cut(s) 21
FokI GGATG 1 cut(s) 262
Fsp4HI GCNGC 1 cut(s) 21
FspBI CTAG 3 cut(s) 24, 33, 135
GluI GCNGC 1 cut(s) 21
Hin1I GRCGYC 1 cut(s) 253
Hin1II CATG 4 cut(s) 152, 243, 296, 348
HinfI GANTC 1 cut(s) 174
Hpy166II GTNNAC 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 119, 185
Hpy8I GTNNAC 1 cut(s) 61
HpyCH4IV ACGT 1 cut(s) 253
HpyCH4V TGCA 5 cut(s) 20, 44, 106, 296, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 293
HpyF3I CTNAG 1 cut(s) 209
HpySE526I ACGT 1 cut(s) 253
Hsp92I GRCGYC 1 cut(s) 253
Hsp92II CATG 4 cut(s) 152, 243, 296, 348
Kzo9I GATC 2 cut(s) 115, 232
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 1 cut(s) 342
Lsp1109I GCAGC 1 cut(s) 32
MaeI CTAG 3 cut(s) 24, 33, 135
MaeII ACGT 1 cut(s) 253
MalI GATC 2 cut(s) 117, 234
MboI GATC 2 cut(s) 115, 232
MboII GAAGA 1 cut(s) 227
MluCI AATT 3 cut(s) 87, 157, 282
MnlI CCTC 4 cut(s) 67, 204, 217, 220
MslI CAYNNNNRTG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 293
NcoI CCATGG 1 cut(s) 239
NdeII GATC 2 cut(s) 115, 232
NlaIII CATG 4 cut(s) 152, 243, 296, 348
NlaIV GGNNCC 1 cut(s) 30
PfeI GAWTC 1 cut(s) 174
PkrI GCNGC 1 cut(s) 22
PspN4I GGNNCC 1 cut(s) 30
PspPI GGNCC 2 cut(s) 61, 341
PstI CTGCAG 1 cut(s) 334
RseI CAYNNNNRTG 1 cut(s) 54
SatI GCNGC 1 cut(s) 21
Sau3AI GATC 2 cut(s) 115, 232
Sau96I GGNCC 2 cut(s) 61, 341
SetI ASST 9 cut(s) 25, 34, 78, 99, 168, 210, 215, 231, 256
SfcI CTRYAG 1 cut(s) 330
SinI GGWCC 2 cut(s) 61, 341
SmiMI CAYNNNNRTG 1 cut(s) 54
Sse9I AATT 3 cut(s) 87, 157, 282
SspMI CTAG 3 cut(s) 24, 33, 135
StyI CCWWGG 1 cut(s) 239
TaiI ACGT 1 cut(s) 256
TaqII GACCGA 1 cut(s) 78
TasI AATT 3 cut(s) 87, 157, 282
TfiI GAWTC 1 cut(s) 174
TscAI CASTG 1 cut(s) 303
TseI GCWGC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 80
TspRI CASTG 1 cut(s) 303
VpaK11BI GGWCC 2 cut(s) 61, 341
XapI RAATTY 2 cut(s) 87, 157
XspI CTAG 3 cut(s) 24, 33, 135
ZraI GACGTC 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.