Rmu_sc0001196.1_g000017

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001196.1
Physical Location & Seq
Reverse (-)
91762 .. 92738
977 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001196.1_g000017.1.cds

Sequence Viewer

Length: 450 bp
atgttaactaataatgttttgcttagtcaagagaaattgggagctttggacggtggtttggatattccacacagtgataagaggtttgctggtttctccaaggacaacaagcagcttgatgctgaggtccatcgtaagtatatctatggtggccatgttgctgcatacatgaggactttgatggaggatgaaccagaaaagtatcagagccatttcagtgaatacattaagaaaggaataggagcagataacattgaagagatttacaagaaagtgcatgcagccatcagggccgaccctacaataaaaaaatctgaaaagcctcaacgcttggaacacaagaggtttaacctcaagaagcttacctacgaggaaaggaagaacaaattgatcgagagactgaatgccttcaactcagccgcccatgctgatgacgacgatgatgagtga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

149

Amino Acids

17.2

Weight (kDa)

6.66

Isoelectric Point (pI)

39.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 420
AcoI YGGCCR 1 cut(s) 151
AdeI CACNNNGTG 1 cut(s) 74
AgsI TTSAA 2 cut(s) 257, 412
AluBI AGCT 3 cut(s) 44, 115, 361
AluI AGCT 3 cut(s) 44, 115, 361
Alw26I GTCTC 1 cut(s) 391
AoxI GGCC 2 cut(s) 151, 291
ApeKI GCWGC 3 cut(s) 112, 161, 281
Asp700I GAANNNNTTC 1 cut(s) 407
AspS9I GGNCC 2 cut(s) 127, 291
AvaII GGWCC 1 cut(s) 127
BalI TGGCCA 1 cut(s) 153
BarI GAAGNNNNNNTAC 2 cut(s) 350, 382
BbvCI CCTCAGC 1 cut(s) 123
BbvI GCAGC 3 cut(s) 124, 148, 293
BccI CCATC 3 cut(s) 138, 175, 293
BcoDI GTCTC 1 cut(s) 391
BglI GCCNNNNNGGC 1 cut(s) 290
BisI GCNGC 4 cut(s) 113, 162, 282, 420
BlsI GCNGC 4 cut(s) 114, 163, 283, 421
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 2 cut(s) 127, 291
BmsI GCATC 1 cut(s) 109
Bpu10I CCTNAGC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 338
BsaJI CCNNGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 99
BseGI GGATG 1 cut(s) 193
BseMII CTCAG 2 cut(s) 114, 429
BseXI GCAGC 3 cut(s) 124, 148, 293
BshFI GGCC 2 cut(s) 153, 293
BsmAI GTCTC 1 cut(s) 391
BsmI GAATGC 1 cut(s) 409
BsnI GGCC 2 cut(s) 153, 293
Bsp143I GATC 1 cut(s) 390
BspACI CCGC 1 cut(s) 420
BspANI GGCC 2 cut(s) 153, 293
BspCNI CTCAG 2 cut(s) 115, 428
BssECI CCNNGG 1 cut(s) 99
BssMI GATC 1 cut(s) 390
BssT1I CCWWGG 1 cut(s) 99
Bst4CI ACNGT 2 cut(s) 53, 74
Bst6I CTCTTC 1 cut(s) 252
BstC8I GCNNGC 1 cut(s) 279
BstDEI CTNAG 3 cut(s) 23, 123, 415
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 1 cut(s) 393
BstMAI GTCTC 1 cut(s) 391
BstMBI GATC 1 cut(s) 390
BstMWI GCNNNNNNNGC 2 cut(s) 290, 425
BstNSI RCATGY 1 cut(s) 281
BstV1I GCAGC 3 cut(s) 124, 148, 293
BsuRI GGCC 2 cut(s) 153, 293
BtsCI GGATG 1 cut(s) 193
BtsIMutI CAGTG 2 cut(s) 79, 223
Cac8I GCNNGC 1 cut(s) 279
Cfr13I GGNCC 2 cut(s) 127, 291
CviAII CATG 4 cut(s) 155, 169, 278, 425
CviJI RGCY 9 cut(s) 44, 115, 153, 210, 284, 293, 322, 361, 419
CviKI_1 RGCY 9 cut(s) 44, 115, 153, 210, 284, 293, 322, 361, 419
DdeI CTNAG 3 cut(s) 23, 123, 415
DpnI GATC 1 cut(s) 392
DpnII GATC 1 cut(s) 390
DraIII CACNNNGTG 1 cut(s) 74
EaeI YGGCCR 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 252
EarI CTCTTC 1 cut(s) 252
Eco130I CCWWGG 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 99
ErhI CCWWGG 1 cut(s) 99
FaeI CATG 4 cut(s) 158, 172, 281, 428
FaiI YATR 7 cut(s) 141, 147, 156, 166, 170, 279, 426
FatI CATG 4 cut(s) 154, 168, 277, 424
Fnu4HI GCNGC 4 cut(s) 113, 162, 282, 420
FokI GGATG 1 cut(s) 200
Fsp4HI GCNGC 4 cut(s) 113, 162, 282, 420
GluI GCNGC 4 cut(s) 113, 162, 282, 420
HaeIII GGCC 2 cut(s) 153, 293
Hin1II CATG 4 cut(s) 158, 172, 281, 428
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HindIII AAGCTT 1 cut(s) 359
HpaI GTTAAC 1 cut(s) 6
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 207, 316
Hpy188III TCNNGA 3 cut(s) 29, 355, 394
Hpy8I GTNNAC 1 cut(s) 6
Hpy99I CGWCG 1 cut(s) 440
HpyAV CCTTC 1 cut(s) 418
HpyCH4III ACNGT 2 cut(s) 53, 74
HpyCH4V TGCA 3 cut(s) 164, 277, 281
HpyF10VI GCNNNNNNNGC 2 cut(s) 290, 425
HpyF3I CTNAG 3 cut(s) 23, 123, 415
Hsp92II CATG 4 cut(s) 158, 172, 281, 428
KspAI GTTAAC 1 cut(s) 6
Kzo9I GATC 1 cut(s) 390
LmnI GCTCC 2 cut(s) 41, 242
LpnPI CCDG 3 cut(s) 75, 207, 274
Lsp1109I GCAGC 3 cut(s) 124, 148, 293
LweI GCATC 1 cut(s) 109
MalI GATC 1 cut(s) 392
MboI GATC 1 cut(s) 390
MboII GAAGA 2 cut(s) 269, 391
MlsI TGGCCA 1 cut(s) 153
MluCI AATT 2 cut(s) 35, 386
MluNI TGGCCA 1 cut(s) 153
MnlI CCTC 8 cut(s) 75, 118, 165, 178, 333, 336, 362, 364
Mox20I TGGCCA 1 cut(s) 153
MroXI GAANNNNTTC 1 cut(s) 407
MscI TGGCCA 1 cut(s) 153
MseI TTAA 3 cut(s) 5, 228, 348
MslI CAYNNNNRTG 2 cut(s) 216, 429
Msp20I TGGCCA 1 cut(s) 153
Mva1269I GAATGC 1 cut(s) 409
MwoI GCNNNNNNNGC 2 cut(s) 290, 425
NdeII GATC 1 cut(s) 390
NlaIII CATG 4 cut(s) 158, 172, 281, 428
NspI RCATGY 1 cut(s) 281
PaeI GCATGC 1 cut(s) 281
PctI GAATGC 1 cut(s) 409
PdmI GAANNNNTTC 1 cut(s) 407
PkrI GCNGC 4 cut(s) 114, 163, 283, 421
PspPI GGNCC 2 cut(s) 127, 291
RseI CAYNNNNRTG 2 cut(s) 216, 429
SaqAI TTAA 3 cut(s) 5, 228, 348
SatI GCNGC 4 cut(s) 113, 162, 282, 420
Sau3AI GATC 1 cut(s) 390
Sau96I GGNCC 2 cut(s) 127, 291
SetI ASST 8 cut(s) 46, 86, 117, 129, 347, 354, 363, 368
SfaNI GCATC 1 cut(s) 109
SinI GGWCC 1 cut(s) 127
SmiMI CAYNNNNRTG 2 cut(s) 216, 429
SmlI CTYRAG 1 cut(s) 353
SmoI CTYRAG 1 cut(s) 353
SphI GCATGC 1 cut(s) 281
Sse9I AATT 2 cut(s) 35, 386
SsiI CCGC 1 cut(s) 420
StyI CCWWGG 1 cut(s) 99
TaaI ACNGT 2 cut(s) 53, 74
TaqI TCGA 1 cut(s) 393
TasI AATT 2 cut(s) 35, 386
TauI GCSGC 1 cut(s) 422
Tru1I TTAA 3 cut(s) 5, 228, 348
Tru9I TTAA 3 cut(s) 5, 228, 348
TscAI CASTG 2 cut(s) 79, 223
TseI GCWGC 3 cut(s) 112, 161, 281
TspDTI ATGAA 1 cut(s) 204
TspRI CASTG 2 cut(s) 79, 223
VpaK11BI GGWCC 1 cut(s) 127
XceI RCATGY 1 cut(s) 281
XmnI GAANNNNTTC 1 cut(s) 407
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.