Rmu_ssc0000204.1_g000006

60S ribosomal Protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000204.1
Physical Location & Seq
Reverse (-)
21778 .. 23941
2164 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000204.1_g000006.1.cds

Sequence Viewer

Length: 501 bp
atggatcaaaatttatcagattcatcttcagatgctgcaaatgaggaattttgggatcttgtcaattcatcatcagacgaagaattgatgaatctggagattgctgctctacaagagaagggaagaagaagacgttggggctcaattcctggtcgcatatataaagatggagctttggacggttgtttggatattccacacagtgataagaggtttgctggtttctccaaggactacaagcagcttgatgctgaggtgcatcccaagtatatctatggtggccatgttgctgcatacatgaggactttgatggaggatgaaccagaaaagtatcagagccatttcagtgaatacattaagaaaggaatagtagcagataacattgaagagatttacaagaaagtgcatgcagccatcagggccgaccctgcaatgaagaaatctgaaaagcctcaacacttggaacacaagagcataatctcaattgatttgcaagattaa
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

19.0

Weight (kDa)

5.38

Isoelectric Point (pI)

60.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 12, 63
AcoI YGGCCR 1 cut(s) 280
AcsI RAATTY 2 cut(s) 10, 47
AcuI CTGAAG 1 cut(s) 12
AdeI CACNNNGTG 1 cut(s) 203
AgsI TTSAA 1 cut(s) 386
AjnI CCWGG 1 cut(s) 148
AjuI GAANNNNNNNTTGG 2 cut(s) 118, 150
AluBI AGCT 2 cut(s) 173, 244
AluI AGCT 2 cut(s) 173, 244
AlwI GGATC 2 cut(s) 12, 63
AlwNI CAGNNNCTG 1 cut(s) 35
AoxI GGCC 2 cut(s) 280, 420
ApeKI GCWGC 5 cut(s) 35, 104, 241, 290, 410
ApoI RAATTY 2 cut(s) 10, 47
AspS9I GGNCC 1 cut(s) 420
BalI TGGCCA 1 cut(s) 282
BanII GRGCYC 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 136
BbvCI CCTCAGC 1 cut(s) 252
BbvI GCAGC 5 cut(s) 22, 91, 253, 277, 422
BccI CCATC 3 cut(s) 161, 304, 422
BciT130I CCWGG 1 cut(s) 150
BglI GCCNNNNNGGC 1 cut(s) 419
BisI GCNGC 5 cut(s) 36, 105, 242, 291, 411
BlsI GCNGC 5 cut(s) 37, 106, 243, 292, 412
Bme1390I CCNGG 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 420
BmrFI CCNGG 1 cut(s) 150
BmsI GCATC 3 cut(s) 22, 238, 268
BpiI GAAGAC 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 116
Bpu10I CCTNAGC 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 228
Bse3DI GCAATG 1 cut(s) 438
BseBI CCWGG 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 228
BseGI GGATG 2 cut(s) 259, 322
BseMI GCAATG 1 cut(s) 438
BseMII CTCAG 1 cut(s) 243
BseXI GCAGC 5 cut(s) 22, 91, 253, 277, 422
BshFI GGCC 2 cut(s) 282, 422
BsnI GGCC 2 cut(s) 282, 422
Bsp1286I GDGCHC 1 cut(s) 143
Bsp143I GATC 2 cut(s) 4, 55
BspANI GGCC 2 cut(s) 282, 422
BspCNI CTCAG 1 cut(s) 244
BspPI GGATC 2 cut(s) 12, 63
BsrDI GCAATG 1 cut(s) 438
BssECI CCNNGG 1 cut(s) 228
BssMI GATC 2 cut(s) 4, 55
BssT1I CCWWGG 1 cut(s) 228
Bst2UI CCWGG 1 cut(s) 150
Bst4CI ACNGT 2 cut(s) 182, 203
Bst6I CTCTTC 1 cut(s) 381
BstC8I GCNNGC 1 cut(s) 408
BstDEI CTNAG 1 cut(s) 252
BstF5I GGATG 2 cut(s) 259, 322
BstKTI GATC 2 cut(s) 7, 58
BstMBI GATC 2 cut(s) 4, 55
BstMWI GCNNNNNNNGC 2 cut(s) 419, 428
BstNI CCWGG 1 cut(s) 150
BstNSI RCATGY 1 cut(s) 410
BstSCI CCNGG 1 cut(s) 148
BstV1I GCAGC 5 cut(s) 22, 91, 253, 277, 422
BstV2I GAAGAC 1 cut(s) 136
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
BsuRI GGCC 2 cut(s) 282, 422
BtsCI GGATG 2 cut(s) 259, 322
BtsIMutI CAGTG 2 cut(s) 208, 352
Cac8I GCNNGC 1 cut(s) 408
CaiI CAGNNNCTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 420
CviAII CATG 3 cut(s) 284, 298, 407
CviJI RGCY 8 cut(s) 141, 173, 244, 282, 339, 413, 422, 451
CviKI_1 RGCY 8 cut(s) 141, 173, 244, 282, 339, 413, 422, 451
DdeI CTNAG 1 cut(s) 252
DpnI GATC 2 cut(s) 6, 57
DpnII GATC 2 cut(s) 4, 55
DraIII CACNNNGTG 1 cut(s) 203
EaeI YGGCCR 1 cut(s) 280
Eam1104I CTCTTC 1 cut(s) 381
EarI CTCTTC 1 cut(s) 381
Eco130I CCWWGG 1 cut(s) 228
Eco24I GRGCYC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 228
EcoT38I GRGCYC 1 cut(s) 143
ErhI CCWWGG 1 cut(s) 228
FaeI CATG 3 cut(s) 287, 301, 410
FatI CATG 3 cut(s) 283, 297, 406
Fnu4HI GCNGC 5 cut(s) 36, 105, 242, 291, 411
FokI GGATG 2 cut(s) 246, 329
FriOI GRGCYC 1 cut(s) 143
Fsp4HI GCNGC 5 cut(s) 36, 105, 242, 291, 411
GluI GCNGC 5 cut(s) 36, 105, 242, 291, 411
GsuI CTGGAG 1 cut(s) 116
HaeIII GGCC 2 cut(s) 282, 422
Hin1II CATG 3 cut(s) 287, 301, 410
HinfI GANTC 2 cut(s) 20, 91
Hpy188I TCNGA 5 cut(s) 19, 31, 76, 336, 445
Hpy188III TCNNGA 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 112
HpyCH4III ACNGT 2 cut(s) 182, 203
HpyCH4IV ACGT 1 cut(s) 133
HpyCH4V TGCA 7 cut(s) 38, 259, 293, 406, 410, 431, 493
HpyF10VI GCNNNNNNNGC 2 cut(s) 419, 428
HpyF3I CTNAG 1 cut(s) 252
HpySE526I ACGT 1 cut(s) 133
Hsp92II CATG 3 cut(s) 287, 301, 410
Kzo9I GATC 2 cut(s) 4, 55
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 7 cut(s) 80, 135, 162, 204, 336, 403, 441
Lsp1109I GCAGC 5 cut(s) 22, 91, 253, 277, 422
LweI GCATC 3 cut(s) 22, 238, 268
MaeII ACGT 1 cut(s) 133
MalI GATC 2 cut(s) 6, 57
MboI GATC 2 cut(s) 4, 55
MboII GAAGA 7 cut(s) 18, 92, 135, 138, 141, 398, 448
MfeI CAATTG 1 cut(s) 483
MflI RGATCY 1 cut(s) 55
MhlI GDGCHC 1 cut(s) 143
MlsI TGGCCA 1 cut(s) 282
MluCI AATT 6 cut(s) 10, 47, 64, 83, 144, 483
MluNI TGGCCA 1 cut(s) 282
MnlI CCTC 6 cut(s) 37, 204, 247, 294, 307, 462
Mox20I TGGCCA 1 cut(s) 282
MscI TGGCCA 1 cut(s) 282
MseI TTAA 2 cut(s) 357, 499
MslI CAYNNNNRTG 1 cut(s) 345
Msp20I TGGCCA 1 cut(s) 282
MspR9I CCNGG 1 cut(s) 150
MunI CAATTG 1 cut(s) 483
MvaI CCWGG 1 cut(s) 150
MwoI GCNNNNNNNGC 2 cut(s) 419, 428
NdeII GATC 2 cut(s) 4, 55
NlaIII CATG 3 cut(s) 287, 301, 410
NspI RCATGY 1 cut(s) 410
PaeI GCATGC 1 cut(s) 410
PfeI GAWTC 2 cut(s) 20, 91
PkrI GCNGC 5 cut(s) 37, 106, 243, 292, 412
Psp6I CCWGG 1 cut(s) 148
PspGI CCWGG 1 cut(s) 148
PspPI GGNCC 1 cut(s) 420
PstNI CAGNNNCTG 1 cut(s) 35
PsuI RGATCY 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 345
SaqAI TTAA 2 cut(s) 357, 499
SatI GCNGC 5 cut(s) 36, 105, 242, 291, 411
Sau3AI GATC 2 cut(s) 4, 55
Sau96I GGNCC 1 cut(s) 420
ScrFI CCNGG 1 cut(s) 150
SduI GDGCHC 1 cut(s) 143
SetI ASST 5 cut(s) 136, 175, 215, 246, 258
SfaNI GCATC 3 cut(s) 22, 238, 268
SmiMI CAYNNNNRTG 1 cut(s) 345
SphI GCATGC 1 cut(s) 410
Sse9I AATT 6 cut(s) 10, 47, 64, 83, 144, 483
StyD4I CCNGG 1 cut(s) 148
StyI CCWWGG 1 cut(s) 228
TaaI ACNGT 2 cut(s) 182, 203
TaiI ACGT 1 cut(s) 136
TasI AATT 6 cut(s) 10, 47, 64, 83, 144, 483
TfiI GAWTC 2 cut(s) 20, 91
Tru1I TTAA 2 cut(s) 357, 499
Tru9I TTAA 2 cut(s) 357, 499
TscAI CASTG 2 cut(s) 208, 352
TseI GCWGC 5 cut(s) 35, 104, 241, 290, 410
TspDTI ATGAA 5 cut(s) 12, 57, 104, 333, 449
TspRI CASTG 2 cut(s) 208, 352
XapI RAATTY 2 cut(s) 10, 47
XceI RCATGY 1 cut(s) 410
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.