Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001886.1

Orthogroup ID

OG0006302

Physical Location & Seq

Genomic Coordinates Forward (+)

33737 .. 35014

Gene Structure 1278 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001886.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1278 bp

atgggttgtcggagaggagcacaaatggagaagccaatgcatggatcagcaatcgtgccttaccttccactcgatgtaatcgccgaaatacttgcaaaactttctgtcaaatccttgttgcaatttagagttgtgtgcaagtcatggtgctccttaatctcaagtcatcaatttgtcaaaaagtatttgtcaaaagtcaccaccagtccttcaagactaatcatgaatccttttggcttggttaacgacttgactttctaccatcttcatgattccatagtagtccgtgaaagttcaatcgatttccggatcgaagaatctgagtactgtgtcatgggttcttgtgacggtttagtatgtgtaaaagaatgtcaccatggtatgatcttcctctggaatccaagtacaagatacgccaaaatattaccttgttcttccgaagtacatgggaaagtgtatgaacttgaatggaagtatggattcggtcacgactgcaatagtgacgactacaaggtgctaacattgagtcctgaagaaaatactcttgataagatggagtactttagttataaatccatgatgtacacattaggaacaaactcttggaggaggattcgggattcaccacttggttgtgtgtttatcgacaagtctgctacttttgtaagtggagctctacattggatggcggatcaagaaccaagtcttactagggtaattatttctcttgatttaacaagtgagacatacatagaagtgccacaacctgattatgagtattcttctgaacttgctgaagtgggggcttcaagaggatgcttatgcttgcttgcttactacaatgatgaatattatgatatttgggtgatgaatgaatatggggtgcgagagtcttggaccaaatcgatcaaaatcccatttatgtgggaatttcttggctgcttaaaaccgctgacatggtttatcgagaacggggaaattatattgagtataggtgggaatgtggcttcctacaatgcaaacagaaactcagttaggtatctttcaactaaaaatgatgattatttatatcggacccctgaatatgccttttatgtagagagcctagtctcacccaatgcctacagtggagacaacgagattagtcatctcaatatcaatatcgtacaagaaaaaagagtggtgataaatgcatgtggagcaacagaaaacggcttcacttcaatcacttggcagctccaggatacagaggaatcatgcattcagcagtactgctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBA_1

Protein Analysis

425

Amino Acids

48.67

Weight (kDa)

5.18

Isoelectric Point (pI)

48.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006302)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G23880
fragaria_vesca	FvH4_3g02101 FvH4_3g18092 FvH4_3g18231 FvH4_3g19151
rosa_chinensis	RchiOBHm_Chr2g0155951 RchiOBHm_Chr5g0030201 RchiOBHm_Chr5g0030271 RchiOBHm_Chr5g0030361 RchiOBHm_Chr5g0030461 RchiOBHm_Chr5g0030551
rosa_laevigata	RLG00000020877 RLG00000031085 RLG00000033219 RLG00000033225 RLG00000033227 RLG00000033371
rosa_multiflora	Rmu_sc0001886.1_g000005 Rmu_sc0013101.1_g000003
rosa_roxburghii	Rroxscaffold_1G00049740 Rroxscaffold_1G00049760
rosa_samantha	Rh2BG513000 Rh2DG524600 Rh5AG026200 Rh5BG027400 Rh5CG029000
rosa_wichuraiana	Rw5G019270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	570
AccB7I	CCANNNNNTGG	1 cut(s)	41
AccIII	TCCGGA	1 cut(s)	306
AciI	CCGC	2 cut(s)	689, 950
AclWI	GGATC	3 cut(s)	52, 317, 699
AcsI	RAATTY	1 cut(s)	929
AcuI	CTGAAG	2 cut(s)	552, 816
AfaI	GTAC	7 cut(s)	326, 406, 444, 560, 584, 1167, 1271
AfiI	CCNNNNNNNGG	1 cut(s)	41
AgsI	TTSAA	6 cut(s)	213, 297, 467, 810, 1047, 1224
AjnI	CCWGG	1 cut(s)	1239
AjuI	GAANNNNNNNTTGG	2 cut(s)	586, 618
AluBI	AGCT	2 cut(s)	674, 1237
AluI	AGCT	2 cut(s)	674, 1237
Alw21I	GWGCWC	3 cut(s)	22, 152, 676
Alw26I	GTCTC	3 cut(s)	737, 1114, 1125
AlwI	GGATC	3 cut(s)	52, 317, 699
Aor13HI	TCCGGA	1 cut(s)	306
ApeKI	GCWGC	2 cut(s)	939, 1234
ApoI	RAATTY	1 cut(s)	929
AspS9I	GGNCC	2 cut(s)	897, 1074
AsuHPI	GGTGA	6 cut(s)	190, 365, 615, 877, 1104, 1195
AvaII	GGWCC	2 cut(s)	897, 1074
BanII	GRGCYC	1 cut(s)	676
Bbv12I	GWGCWC	3 cut(s)	22, 152, 676
BbvI	GCAGC	2 cut(s)	926, 1246
BccI	CCATC	3 cut(s)	270, 547, 679
BceAI	ACGGC	1 cut(s)	1228
BcgI	CGANNNNNNTGC	4 cut(s)	74, 108, 635, 669
BciT130I	CCWGG	1 cut(s)	1241
BciVI	GTATCC	1 cut(s)	1237
BcoDI	GTCTC	3 cut(s)	737, 1114, 1125
BfaI	CTAG	2 cut(s)	711, 1106
BfmI	CTRYAG	1 cut(s)	1123
BfuI	GTATCC	1 cut(s)	1237
BisI	GCNGC	2 cut(s)	940, 1235
BlsI	GCNGC	2 cut(s)	941, 1236
BmcAI	AGTACT	3 cut(s)	326, 560, 1271
Bme1390I	CCNGG	1 cut(s)	1241
Bme18I	GGWCC	2 cut(s)	897, 1074
BmgT120I	GGNCC	2 cut(s)	897, 1074
BmiI	GGNNCC	1 cut(s)	1076
BmrFI	CCNGG	1 cut(s)	1241
BmsI	GCATC	1 cut(s)	806
BpmI	CTGGAG	1 cut(s)	1223
BpuEI	CTTGAG	1 cut(s)	145
Bsa29I	ATCGAT	2 cut(s)	300, 905
BsaBI	GATNNNNATC	1 cut(s)	911
BsaJI	CCNNGG	1 cut(s)	376
BsaWI	WCCGGW	1 cut(s)	306
Bsc4I	CCNNNNNNNGG	1 cut(s)	41
Bse1I	ACTGG	1 cut(s)	204
Bse8I	GATNNNNATC	1 cut(s)	911
BseAI	TCCGGA	1 cut(s)	306
BseBI	CCWGG	1 cut(s)	1241
BseCI	ATCGAT	2 cut(s)	300, 905
BseDI	CCNNGG	1 cut(s)	376
BseGI	GGATG	2 cut(s)	690, 821
BseJI	GATNNNNATC	1 cut(s)	911
BseLI	CCNNNNNNNGG	1 cut(s)	41
BseMII	CTCAG	2 cut(s)	312, 1044
BseNI	ACTGG	1 cut(s)	204
BseRI	GAGGAG	2 cut(s)	30, 622
BseXI	GCAGC	2 cut(s)	926, 1246
BshVI	ATCGAT	2 cut(s)	300, 905
BsiHKAI	GWGCWC	3 cut(s)	22, 152, 676
BsiSI	CCGG	1 cut(s)	307
BslI	CCNNNNNNNGG	1 cut(s)	41
BsmAI	GTCTC	3 cut(s)	737, 1114, 1125
BsmI	GAATGC	1 cut(s)	1260
Bsp1286I	GDGCHC	3 cut(s)	22, 152, 676
Bsp13I	TCCGGA	1 cut(s)	306
Bsp1407I	TGTACA	1 cut(s)	582
Bsp143I	GATC	5 cut(s)	44, 309, 384, 691, 906
Bsp19I	CCATGG	1 cut(s)	376
BspACI	CCGC	2 cut(s)	689, 950
BspCNI	CTCAG	2 cut(s)	313, 1043
BspDI	ATCGAT	2 cut(s)	300, 905
BspEI	TCCGGA	1 cut(s)	306
BspHI	TCATGA	2 cut(s)	222, 268
BspLI	GGNNCC	1 cut(s)	1076
BspPI	GGATC	3 cut(s)	52, 317, 699
BsrGI	TGTACA	1 cut(s)	582
BsrI	ACTGG	1 cut(s)	204
BssECI	CCNNGG	1 cut(s)	376
BssMI	GATC	5 cut(s)	44, 309, 384, 691, 906
BssT1I	CCWWGG	1 cut(s)	376
Bst2UI	CCWGG	1 cut(s)	1241
Bst4CI	ACNGT	3 cut(s)	329, 350, 1127
BstAUI	TGTACA	1 cut(s)	582
BstC8I	GCNNGC	2 cut(s)	827, 831
BstDEI	CTNAG	2 cut(s)	321, 1030
BstDSI	CCRYGG	1 cut(s)	376
BstF5I	GGATG	2 cut(s)	690, 821
BstKTI	GATC	5 cut(s)	47, 312, 387, 694, 909
BstMAI	GTCTC	3 cut(s)	737, 1114, 1125
BstMBI	GATC	5 cut(s)	44, 309, 384, 691, 906
BstMWI	GCNNNNNNNGC	1 cut(s)	1199
BstNI	CCWGG	1 cut(s)	1241
BstNSI	RCATGY	1 cut(s)	1197
BstSCI	CCNGG	1 cut(s)	1239
BstSFI	CTRYAG	1 cut(s)	1123
BstV1I	GCAGC	2 cut(s)	926, 1246
BstXI	CCANNNNNNTGG	1 cut(s)	924
Bsu15I	ATCGAT	2 cut(s)	300, 905
BsuI	GTATCC	1 cut(s)	1237
BsuTUI	ATCGAT	2 cut(s)	300, 905
BtgI	CCRYGG	1 cut(s)	376
BtsCI	GGATG	2 cut(s)	690, 821
BtsIMutI	CAGTG	1 cut(s)	1132
Cac8I	GCNNGC	2 cut(s)	827, 831
CciI	TCATGA	2 cut(s)	222, 268
Cfr13I	GGNCC	2 cut(s)	897, 1074
ClaI	ATCGAT	2 cut(s)	300, 905
Csp6I	GTAC	7 cut(s)	325, 405, 443, 559, 583, 1166, 1270
CviJI	RGCY	9 cut(s)	34, 237, 674, 806, 939, 1007, 1104, 1215, 1237
CviKI_1	RGCY	9 cut(s)	34, 237, 674, 806, 939, 1007, 1104, 1215, 1237
CviQI	GTAC	7 cut(s)	325, 405, 443, 559, 583, 1166, 1270
DdeI	CTNAG	2 cut(s)	321, 1030
DpnI	GATC	5 cut(s)	46, 311, 386, 693, 908
DpnII	GATC	5 cut(s)	44, 309, 384, 691, 906
EciI	GGCGGA	1 cut(s)	704
Ecl136II	GAGCTC	1 cut(s)	674
Eco130I	CCWWGG	1 cut(s)	376
Eco24I	GRGCYC	1 cut(s)	676
Eco47I	GGWCC	2 cut(s)	897, 1074
Eco53kI	GAGCTC	1 cut(s)	674
Eco57I	CTGAAG	2 cut(s)	552, 816
EcoICRI	GAGCTC	1 cut(s)	674
EcoRII	CCWGG	1 cut(s)	1239
EcoT14I	CCWWGG	1 cut(s)	376
EcoT22I	ATGCAT	3 cut(s)	42, 1195, 1262
EcoT38I	GRGCYC	1 cut(s)	676
ErhI	CCWWGG	1 cut(s)	376
Fnu4HI	GCNGC	2 cut(s)	940, 1235
FokI	GGATG	2 cut(s)	697, 828
FriOI	GRGCYC	1 cut(s)	676
Fsp4HI	GCNGC	2 cut(s)	940, 1235
FspBI	CTAG	2 cut(s)	711, 1106
GluI	GCNGC	2 cut(s)	940, 1235
GsuI	CTGGAG	1 cut(s)	1223
HapII	CCGG	1 cut(s)	307
HincII	GTYRAC	1 cut(s)	244
HindII	GTYRAC	1 cut(s)	244
HpaI	GTTAAC	1 cut(s)	244
HpaII	CCGG	1 cut(s)	307
HphI	GGTGA	6 cut(s)	190, 365, 615, 877, 1104, 1195
Hpy166II	GTNNAC	2 cut(s)	244, 585
Hpy188I	TCNGA	5 cut(s)	12, 322, 439, 787, 1074
Hpy8I	GTNNAC	2 cut(s)	244, 585
HpyAV	CCTTC	2 cut(s)	74, 219
HpyCH4III	ACNGT	3 cut(s)	329, 350, 1127
HpyCH4V	TGCA	8 cut(s)	40, 95, 121, 138, 495, 1019, 1193, 1260
HpyF10VI	GCNNNNNNNGC	1 cut(s)	1199
HpyF3I	CTNAG	2 cut(s)	321, 1030
Kpn2I	TCCGGA	1 cut(s)	306
KspAI	GTTAAC	1 cut(s)	244
Kzo9I	GATC	5 cut(s)	44, 309, 384, 691, 906
LmnI	GCTCC	5 cut(s)	17, 155, 671, 1199, 1242
LpnPI	CCDG	8 cut(s)	217, 320, 379, 543, 780, 1092, 1226, 1253
Lsp1109I	GCAGC	2 cut(s)	926, 1246
LweI	GCATC	1 cut(s)	806
MaeI	CTAG	2 cut(s)	711, 1106
MaeIII	GTNAC	5 cut(s)	196, 344, 371, 485, 500
MalI	GATC	5 cut(s)	46, 311, 386, 693, 908
MboI	GATC	5 cut(s)	44, 309, 384, 691, 906
MboII	GAAGA	6 cut(s)	257, 326, 379, 426, 545, 774
MhlI	GDGCHC	3 cut(s)	22, 152, 676
MluCI	AATT	5 cut(s)	122, 170, 717, 929, 978
MlyI	GAGTC	2 cut(s)	535, 899
MnlI	CCTC	6 cut(s)	8, 401, 600, 603, 806, 1243
Mph1103I	ATGCAT	3 cut(s)	42, 1195, 1262
MroI	TCCGGA	1 cut(s)	306
MseI	TTAA	4 cut(s)	155, 243, 734, 944
MslI	CAYNNNNRTG	3 cut(s)	267, 755, 922
MspA1I	CMGCKG	1 cut(s)	952
MspI	CCGG	1 cut(s)	307
MspR9I	CCNGG	1 cut(s)	1241
Mva1269I	GAATGC	1 cut(s)	1260
MvaI	CCWGG	1 cut(s)	1241
MwoI	GCNNNNNNNGC	1 cut(s)	1199
NcoI	CCATGG	1 cut(s)	376
NdeII	GATC	5 cut(s)	44, 309, 384, 691, 906
NlaIV	GGNNCC	1 cut(s)	1076
NmuCI	GTSAC	5 cut(s)	196, 344, 371, 485, 500
NsiI	ATGCAT	3 cut(s)	42, 1195, 1262
NspI	RCATGY	1 cut(s)	1197
PagI	TCATGA	2 cut(s)	222, 268
PctI	GAATGC	1 cut(s)	1260
PfeI	GAWTC	8 cut(s)	226, 272, 317, 397, 480, 613, 620, 1253
PflMI	CCANNNNNTGG	1 cut(s)	41
PfoI	TCCNGGA	1 cut(s)	1239
PkrI	GCNGC	2 cut(s)	941, 1236
PleI	GAGTC	2 cut(s)	534, 898
PpsI	GAGTC	2 cut(s)	534, 898
PsiI	TTATAA	1 cut(s)	570
Psp124BI	GAGCTC	1 cut(s)	676
Psp6I	CCWGG	1 cut(s)	1239
PspGI	CCWGG	1 cut(s)	1239
PspN4I	GGNNCC	1 cut(s)	1076
PspPI	GGNCC	2 cut(s)	897, 1074
RsaI	GTAC	7 cut(s)	326, 406, 444, 560, 584, 1167, 1271
RsaNI	GTAC	7 cut(s)	325, 405, 443, 559, 583, 1166, 1270
RseI	CAYNNNNRTG	3 cut(s)	267, 755, 922
SacI	GAGCTC	1 cut(s)	676
SaqAI	TTAA	4 cut(s)	155, 243, 734, 944
SatI	GCNGC	2 cut(s)	940, 1235
Sau3AI	GATC	5 cut(s)	44, 309, 384, 691, 906
Sau96I	GGNCC	2 cut(s)	897, 1074
ScaI	AGTACT	3 cut(s)	326, 560, 1271
SchI	GAGTC	2 cut(s)	535, 899
ScrFI	CCNGG	1 cut(s)	1241
SduI	GDGCHC	3 cut(s)	22, 152, 676
SetI	ASST	8 cut(s)	66, 430, 516, 676, 769, 997, 1040, 1239
SfaNI	GCATC	1 cut(s)	806
SfcI	CTRYAG	1 cut(s)	1123
SinI	GGWCC	2 cut(s)	897, 1074
SmiMI	CAYNNNNRTG	3 cut(s)	267, 755, 922
SmlI	CTYRAG	1 cut(s)	160
SmoI	CTYRAG	1 cut(s)	160
Sse9I	AATT	5 cut(s)	122, 170, 717, 929, 978
SsiI	CCGC	2 cut(s)	689, 950
SspI	AATATT	2 cut(s)	423, 851
SspMI	CTAG	2 cut(s)	711, 1106
SstI	GAGCTC	1 cut(s)	676
StyD4I	CCNGG	1 cut(s)	1239
StyI	CCWWGG	1 cut(s)	376
TaaI	ACNGT	3 cut(s)	329, 350, 1127
TaqI	TCGA	6 cut(s)	72, 300, 312, 645, 905, 966
TaqII	GACCGA	1 cut(s)	473
TasI	AATT	5 cut(s)	122, 170, 717, 929, 978
TatI	WGTACW	6 cut(s)	324, 404, 442, 558, 582, 1269
TfiI	GAWTC	8 cut(s)	226, 272, 317, 397, 480, 613, 620, 1253
Tru1I	TTAA	4 cut(s)	155, 243, 734, 944
Tru9I	TTAA	4 cut(s)	155, 243, 734, 944
TscAI	CASTG	1 cut(s)	1132
TseFI	GTSAC	5 cut(s)	196, 344, 371, 485, 500
TseI	GCWGC	2 cut(s)	939, 1234
Tsp45I	GTSAC	5 cut(s)	196, 344, 371, 485, 500
TspDTI	ATGAA	6 cut(s)	239, 257, 474, 861, 884, 888
TspGWI	ACGGA	1 cut(s)	275
TspRI	CASTG	1 cut(s)	1132
Van91I	CCANNNNNTGG	1 cut(s)	41
VpaK11BI	GGWCC	2 cut(s)	897, 1074
XapI	RAATTY	1 cut(s)	929
XceI	RCATGY	1 cut(s)	1197
XspI	CTAG	2 cut(s)	711, 1106
ZrmI	AGTACT	3 cut(s)	326, 560, 1271
Zsp2I	ATGCAT	3 cut(s)	42, 1195, 1262

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.