Rmu_sc0001998.1_g000029

At2g34160-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001998.1
Physical Location & Seq
Forward (+)
128338 .. 131216
2879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001998.1_g000029.1.cds

Sequence Viewer

Length: 417 bp
atggaggctgttgtagagattaccgaggctatgaacaacgtcaccatcaacaactcagattcacacaagaagaaccgaattcaggtctcgaacaccaaaaagcccctcttcttctacgtcaatctcgccaagaggtatatgcagcagtacaatgaggtggagctatctgccttgggaatggctattgccacagttgtgacaattgcagaaattctcaagaacaatgggctggctgttgagaaaaaaatcatgacatcaactgttgacataaaggatgattctagagggagaccagtccaaaaagccaagattgagatattgcttgggaagacagcaaatttcgatgacttgatggctgcagctgccgaggagagggaacttgcagcagcagcagcagaggctgaggagcaaagctga
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

138

Amino Acids

15.2

Weight (kDa)

5.27

Isoelectric Point (pI)

39.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 3 cut(s) 78, 210, 337
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 2 cut(s) 82, 372
AleI CACNNNNGTG 1 cut(s) 194
AluBI AGCT 3 cut(s) 163, 362, 414
AluI AGCT 3 cut(s) 163, 362, 414
Alw26I GTCTC 2 cut(s) 91, 283
AlwNI CAGNNNCTG 1 cut(s) 401
ApeKI GCWGC 8 cut(s) 142, 356, 359, 362, 383, 386, 389, 392
ApoI RAATTY 3 cut(s) 78, 210, 337
AsuHPI GGTGA 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 335
BbvCI CCTCAGC 1 cut(s) 402
BbvI GCAGC 8 cut(s) 154, 343, 349, 371, 395, 398, 401, 404
BccI CCATC 2 cut(s) 53, 346
BcoDI GTCTC 2 cut(s) 91, 283
BfaI CTAG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 357
BisI GCNGC 8 cut(s) 143, 357, 360, 363, 384, 387, 390, 393
BlsI GCNGC 8 cut(s) 144, 358, 361, 364, 385, 388, 391, 394
BpiI GAAGAC 1 cut(s) 335
Bpu10I CCTNAGC 1 cut(s) 402
BpuEI CTTGAG 1 cut(s) 200
BsaI GGTCTC 2 cut(s) 91, 283
BsaJI CCNNGG 3 cut(s) 24, 171, 366
Bsc4I CCNNNNNNNGG 2 cut(s) 82, 372
Bse1I ACTGG 1 cut(s) 293
BseDI CCNNGG 3 cut(s) 24, 171, 366
BseGI GGATG 1 cut(s) 280
BseLI CCNNNNNNNGG 2 cut(s) 82, 372
BseMII CTCAG 2 cut(s) 69, 393
BseNI ACTGG 1 cut(s) 293
BseRI GAGGAG 1 cut(s) 383
BseXI GCAGC 8 cut(s) 154, 343, 349, 371, 395, 398, 401, 404
BslI CCNNNNNNNGG 2 cut(s) 82, 372
BsmAI GTCTC 2 cut(s) 91, 283
Bso31I GGTCTC 2 cut(s) 91, 283
BspCNI CTCAG 2 cut(s) 68, 394
BspHI TCATGA 1 cut(s) 249
BspMAI CTGCAG 1 cut(s) 361
BspTNI GGTCTC 2 cut(s) 91, 283
BsrI ACTGG 1 cut(s) 293
BssECI CCNNGG 3 cut(s) 24, 171, 366
BssT1I CCWWGG 1 cut(s) 171
Bst4CI ACNGT 2 cut(s) 193, 262
Bst6I CTCTTC 1 cut(s) 113
BstC8I GCNNGC 1 cut(s) 231
BstDEI CTNAG 2 cut(s) 55, 402
BstF5I GGATG 1 cut(s) 280
BstMAI GTCTC 2 cut(s) 91, 283
BstMWI GCNNNNNNNGC 4 cut(s) 362, 389, 392, 398
BstSFI CTRYAG 1 cut(s) 357
BstV1I GCAGC 8 cut(s) 154, 343, 349, 371, 395, 398, 401, 404
BstV2I GAAGAC 1 cut(s) 335
BtsCI GGATG 1 cut(s) 280
Cac8I GCNNGC 1 cut(s) 231
CaiI CAGNNNCTG 1 cut(s) 401
CciI TCATGA 1 cut(s) 249
Csp6I GTAC 1 cut(s) 148
CviAII CATG 1 cut(s) 250
CviQI GTAC 1 cut(s) 148
DdeI CTNAG 2 cut(s) 55, 402
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
Eco130I CCWWGG 1 cut(s) 171
Eco31I GGTCTC 2 cut(s) 91, 283
EcoRI GAATTC 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 1 cut(s) 253
FaiI YATR 5 cut(s) 32, 138, 140, 251, 269
FalI AAGNNNNNCTT 2 cut(s) 92, 124
FatI CATG 1 cut(s) 249
Fnu4HI GCNGC 8 cut(s) 143, 357, 360, 363, 384, 387, 390, 393
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 8 cut(s) 143, 357, 360, 363, 384, 387, 390, 393
FspBI CTAG 1 cut(s) 282
GluI GCNGC 8 cut(s) 143, 357, 360, 363, 384, 387, 390, 393
Hin1II CATG 1 cut(s) 253
HincII GTYRAC 1 cut(s) 265
HindII GTYRAC 1 cut(s) 265
HinfI GANTC 2 cut(s) 59, 278
HphI GGTGA 1 cut(s) 34
Hpy166II GTNNAC 1 cut(s) 265
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 4 cut(s) 88, 217, 250, 282
Hpy8I GTNNAC 1 cut(s) 265
HpyCH4III ACNGT 2 cut(s) 193, 262
HpyCH4IV ACGT 2 cut(s) 39, 117
HpyCH4V TGCA 4 cut(s) 142, 206, 359, 383
HpyF10VI GCNNNNNNNGC 4 cut(s) 362, 389, 392, 398
HpyF3I CTNAG 2 cut(s) 55, 402
HpySE526I ACGT 2 cut(s) 39, 117
Hsp92II CATG 1 cut(s) 253
LmnI GCTCC 2 cut(s) 160, 406
LpnPI CCDG 3 cut(s) 68, 215, 306
Lsp1109I GCAGC 8 cut(s) 154, 343, 349, 371, 395, 398, 401, 404
MaeI CTAG 1 cut(s) 282
MaeII ACGT 2 cut(s) 39, 117
MaeIII GTNAC 2 cut(s) 40, 196
MboII GAAGA 4 cut(s) 82, 100, 103, 340
MfeI CAATTG 1 cut(s) 201
MluCI AATT 4 cut(s) 78, 201, 210, 337
MnlI CCTC 9 cut(s) 19, 116, 126, 148, 278, 361, 366, 391, 397
MslI CAYNNNNRTG 1 cut(s) 194
MspA1I CMGCKG 1 cut(s) 362
MunI CAATTG 1 cut(s) 201
MwoI GCNNNNNNNGC 4 cut(s) 362, 389, 392, 398
NlaIII CATG 1 cut(s) 253
NmeAIII GCCGAG 1 cut(s) 391
NmuCI GTSAC 2 cut(s) 40, 196
OliI CACNNNNGTG 1 cut(s) 194
PagI TCATGA 1 cut(s) 249
PfeI GAWTC 2 cut(s) 59, 278
PkrI GCNGC 8 cut(s) 144, 358, 361, 364, 385, 388, 391, 394
PstI CTGCAG 1 cut(s) 361
PstNI CAGNNNCTG 1 cut(s) 401
PvuII CAGCTG 1 cut(s) 362
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
RseI CAYNNNNRTG 1 cut(s) 194
SatI GCNGC 8 cut(s) 143, 357, 360, 363, 384, 387, 390, 393
SetI ASST 8 cut(s) 42, 87, 120, 137, 159, 165, 364, 416
SfcI CTRYAG 1 cut(s) 357
SmiMI CAYNNNNRTG 1 cut(s) 194
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 4 cut(s) 78, 201, 210, 337
SspMI CTAG 1 cut(s) 282
StyI CCWWGG 1 cut(s) 171
TaaI ACNGT 2 cut(s) 193, 262
TaiI ACGT 2 cut(s) 42, 120
TaqI TCGA 2 cut(s) 89, 342
TasI AATT 4 cut(s) 78, 201, 210, 337
TatI WGTACW 1 cut(s) 147
TfiI GAWTC 2 cut(s) 59, 278
TseFI GTSAC 2 cut(s) 40, 196
TseI GCWGC 8 cut(s) 142, 356, 359, 362, 383, 386, 389, 392
Tsp45I GTSAC 2 cut(s) 40, 196
TspDTI ATGAA 1 cut(s) 47
XapI RAATTY 3 cut(s) 78, 210, 337
XbaI TCTAGA 1 cut(s) 281
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.