Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001998.1

Orthogroup ID

OG0002909

Physical Location & Seq

Genomic Coordinates Forward (+)

128338 .. 131216

Gene Structure 2879 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001998.1_g000029.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 417 bp

atggaggctgttgtagagattaccgaggctatgaacaacgtcaccatcaacaactcagattcacacaagaagaaccgaattcaggtctcgaacaccaaaaagcccctcttcttctacgtcaatctcgccaagaggtatatgcagcagtacaatgaggtggagctatctgccttgggaatggctattgccacagttgtgacaattgcagaaattctcaagaacaatgggctggctgttgagaaaaaaatcatgacatcaactgttgacataaaggatgattctagagggagaccagtccaaaaagccaagattgagatattgcttgggaagacagcaaatttcgatgacttgatggctgcagctgccgaggagagggaacttgcagcagcagcagcagaggctgaggagcaaagctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Alba

Protein Analysis

138

Amino Acids

15.2

Weight (kDa)

5.27

Isoelectric Point (pI)

39.73

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002909)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G29250 AT2G34160
fragaria_vesca	FvH4_2g29410 FvH4_6g30150
malus_domestica	MD02G1299500.v1.1 MD08G1147300.v1.1 MD08G1188700.v1.1 MD09G1220100.v1.1 MD15G1123300.v1.1 MD15G1378600.v1.1 MD16G1209300.v1.1 MD17G1207900.v1.1
prunus_persica	Prupe.1G031300_v2.0.a1 Prupe.1G478700_v2.0.a1 Prupe.3G082200_v2.0.a1
pyrus_communis	pycom08g12430 pycom09g13850 pycom15g11110 pycom16g17660 pycom17g21040
rosa_chinensis	RchiOBHm_Chr2g0136361 RchiOBHm_Chr6g0298211
rosa_laevigata	RLG00000011526 RLG00000019523 RLG00000032843
rosa_multiflora	Rmu_sc0001998.1_g000029 Rmu_sc0017507.1_g000004
rosa_roxburghii	Rroxscaffold_2G00108370 Rroxscaffold_7G00169860
rosa_rugosa	Rorug02G0329300 Rorug06G0279600
rosa_samantha	Rh1BG155300 Rh2BG387600 Rh2CG366600 Rh6AG389800 Rh6DG390800
rosa_wichuraiana	Rw2G031140 Rw6G034030

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	78, 210, 337
AfaI	GTAC	1 cut(s)	149
AfiI	CCNNNNNNNGG	2 cut(s)	82, 372
AleI	CACNNNNGTG	1 cut(s)	194
AluBI	AGCT	3 cut(s)	163, 362, 414
AluI	AGCT	3 cut(s)	163, 362, 414
Alw26I	GTCTC	2 cut(s)	91, 283
AlwNI	CAGNNNCTG	1 cut(s)	401
ApeKI	GCWGC	8 cut(s)	142, 356, 359, 362, 383, 386, 389, 392
ApoI	RAATTY	3 cut(s)	78, 210, 337
AsuHPI	GGTGA	1 cut(s)	34
BbsI	GAAGAC	1 cut(s)	335
BbvCI	CCTCAGC	1 cut(s)	402
BbvI	GCAGC	8 cut(s)	154, 343, 349, 371, 395, 398, 401, 404
BccI	CCATC	2 cut(s)	53, 346
BcoDI	GTCTC	2 cut(s)	91, 283
BfaI	CTAG	1 cut(s)	282
BfmI	CTRYAG	1 cut(s)	357
BisI	GCNGC	8 cut(s)	143, 357, 360, 363, 384, 387, 390, 393
BlsI	GCNGC	8 cut(s)	144, 358, 361, 364, 385, 388, 391, 394
BpiI	GAAGAC	1 cut(s)	335
Bpu10I	CCTNAGC	1 cut(s)	402
BpuEI	CTTGAG	1 cut(s)	200
BsaI	GGTCTC	2 cut(s)	91, 283
BsaJI	CCNNGG	3 cut(s)	24, 171, 366
Bsc4I	CCNNNNNNNGG	2 cut(s)	82, 372
Bse1I	ACTGG	1 cut(s)	293
BseDI	CCNNGG	3 cut(s)	24, 171, 366
BseGI	GGATG	1 cut(s)	280
BseLI	CCNNNNNNNGG	2 cut(s)	82, 372
BseMII	CTCAG	2 cut(s)	69, 393
BseNI	ACTGG	1 cut(s)	293
BseRI	GAGGAG	1 cut(s)	383
BseXI	GCAGC	8 cut(s)	154, 343, 349, 371, 395, 398, 401, 404
BslI	CCNNNNNNNGG	2 cut(s)	82, 372
BsmAI	GTCTC	2 cut(s)	91, 283
Bso31I	GGTCTC	2 cut(s)	91, 283
BspCNI	CTCAG	2 cut(s)	68, 394
BspHI	TCATGA	1 cut(s)	249
BspMAI	CTGCAG	1 cut(s)	361
BspTNI	GGTCTC	2 cut(s)	91, 283
BsrI	ACTGG	1 cut(s)	293
BssECI	CCNNGG	3 cut(s)	24, 171, 366
BssT1I	CCWWGG	1 cut(s)	171
Bst4CI	ACNGT	2 cut(s)	193, 262
Bst6I	CTCTTC	1 cut(s)	113
BstC8I	GCNNGC	1 cut(s)	231
BstDEI	CTNAG	2 cut(s)	55, 402
BstF5I	GGATG	1 cut(s)	280
BstMAI	GTCTC	2 cut(s)	91, 283
BstMWI	GCNNNNNNNGC	4 cut(s)	362, 389, 392, 398
BstSFI	CTRYAG	1 cut(s)	357
BstV1I	GCAGC	8 cut(s)	154, 343, 349, 371, 395, 398, 401, 404
BstV2I	GAAGAC	1 cut(s)	335
BtsCI	GGATG	1 cut(s)	280
Cac8I	GCNNGC	1 cut(s)	231
CaiI	CAGNNNCTG	1 cut(s)	401
CciI	TCATGA	1 cut(s)	249
Csp6I	GTAC	1 cut(s)	148
CviAII	CATG	1 cut(s)	250
CviQI	GTAC	1 cut(s)	148
DdeI	CTNAG	2 cut(s)	55, 402
Eam1104I	CTCTTC	1 cut(s)	113
EarI	CTCTTC	1 cut(s)	113
Eco130I	CCWWGG	1 cut(s)	171
Eco31I	GGTCTC	2 cut(s)	91, 283
EcoRI	GAATTC	1 cut(s)	78
EcoT14I	CCWWGG	1 cut(s)	171
ErhI	CCWWGG	1 cut(s)	171
FaeI	CATG	1 cut(s)	253
FaiI	YATR	5 cut(s)	32, 138, 140, 251, 269
FalI	AAGNNNNNCTT	2 cut(s)	92, 124
FatI	CATG	1 cut(s)	249
Fnu4HI	GCNGC	8 cut(s)	143, 357, 360, 363, 384, 387, 390, 393
FokI	GGATG	1 cut(s)	287
Fsp4HI	GCNGC	8 cut(s)	143, 357, 360, 363, 384, 387, 390, 393
FspBI	CTAG	1 cut(s)	282
GluI	GCNGC	8 cut(s)	143, 357, 360, 363, 384, 387, 390, 393
Hin1II	CATG	1 cut(s)	253
HincII	GTYRAC	1 cut(s)	265
HindII	GTYRAC	1 cut(s)	265
HinfI	GANTC	2 cut(s)	59, 278
HphI	GGTGA	1 cut(s)	34
Hpy166II	GTNNAC	1 cut(s)	265
Hpy188I	TCNGA	1 cut(s)	58
Hpy188III	TCNNGA	4 cut(s)	88, 217, 250, 282
Hpy8I	GTNNAC	1 cut(s)	265
HpyCH4III	ACNGT	2 cut(s)	193, 262
HpyCH4IV	ACGT	2 cut(s)	39, 117
HpyCH4V	TGCA	4 cut(s)	142, 206, 359, 383
HpyF10VI	GCNNNNNNNGC	4 cut(s)	362, 389, 392, 398
HpyF3I	CTNAG	2 cut(s)	55, 402
HpySE526I	ACGT	2 cut(s)	39, 117
Hsp92II	CATG	1 cut(s)	253
LmnI	GCTCC	2 cut(s)	160, 406
LpnPI	CCDG	3 cut(s)	68, 215, 306
Lsp1109I	GCAGC	8 cut(s)	154, 343, 349, 371, 395, 398, 401, 404
MaeI	CTAG	1 cut(s)	282
MaeII	ACGT	2 cut(s)	39, 117
MaeIII	GTNAC	2 cut(s)	40, 196
MboII	GAAGA	4 cut(s)	82, 100, 103, 340
MfeI	CAATTG	1 cut(s)	201
MluCI	AATT	4 cut(s)	78, 201, 210, 337
MnlI	CCTC	9 cut(s)	19, 116, 126, 148, 278, 361, 366, 391, 397
MslI	CAYNNNNRTG	1 cut(s)	194
MspA1I	CMGCKG	1 cut(s)	362
MunI	CAATTG	1 cut(s)	201
MwoI	GCNNNNNNNGC	4 cut(s)	362, 389, 392, 398
NlaIII	CATG	1 cut(s)	253
NmeAIII	GCCGAG	1 cut(s)	391
NmuCI	GTSAC	2 cut(s)	40, 196
OliI	CACNNNNGTG	1 cut(s)	194
PagI	TCATGA	1 cut(s)	249
PfeI	GAWTC	2 cut(s)	59, 278
PkrI	GCNGC	8 cut(s)	144, 358, 361, 364, 385, 388, 391, 394
PstI	CTGCAG	1 cut(s)	361
PstNI	CAGNNNCTG	1 cut(s)	401
PvuII	CAGCTG	1 cut(s)	362
RsaI	GTAC	1 cut(s)	149
RsaNI	GTAC	1 cut(s)	148
RseI	CAYNNNNRTG	1 cut(s)	194
SatI	GCNGC	8 cut(s)	143, 357, 360, 363, 384, 387, 390, 393
SetI	ASST	8 cut(s)	42, 87, 120, 137, 159, 165, 364, 416
SfcI	CTRYAG	1 cut(s)	357
SmiMI	CAYNNNNRTG	1 cut(s)	194
SmlI	CTYRAG	1 cut(s)	215
SmoI	CTYRAG	1 cut(s)	215
Sse9I	AATT	4 cut(s)	78, 201, 210, 337
SspMI	CTAG	1 cut(s)	282
StyI	CCWWGG	1 cut(s)	171
TaaI	ACNGT	2 cut(s)	193, 262
TaiI	ACGT	2 cut(s)	42, 120
TaqI	TCGA	2 cut(s)	89, 342
TasI	AATT	4 cut(s)	78, 201, 210, 337
TatI	WGTACW	1 cut(s)	147
TfiI	GAWTC	2 cut(s)	59, 278
TseFI	GTSAC	2 cut(s)	40, 196
TseI	GCWGC	8 cut(s)	142, 356, 359, 362, 383, 386, 389, 392
Tsp45I	GTSAC	2 cut(s)	40, 196
TspDTI	ATGAA	1 cut(s)	47
XapI	RAATTY	3 cut(s)	78, 210, 337
XbaI	TCTAGA	1 cut(s)	281
XspI	CTAG	1 cut(s)	282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.