Rmu_sc0002164.1_g000004

zinc-binding in reverse transcriptase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002164.1
Physical Location & Seq
Reverse (-)
15461 .. 16453
993 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002164.1_g000004.1.cds

Sequence Viewer

Length: 588 bp
atgctcagttttgagaaatcagcagtggctttcaattctcaagtgggggaagtagaacagtctgagtatagtggtcttctgcaaatgcctattgtgccattccatgaaagttatttgggactaccaacaatcgttgggaggaataagaagtctgctttcaagaaagtcaaggacaggttgggtaagagagttacagggtggaaagaaaatttgatgtttaaggcaggaaaattgattggaaatggagaaactacggggatttatagtcacccatggataccaagacctgtaaatttcaaaccgtacactccagcaagtgtggcattggatactctggtaagctttttgatgtcggggacaggaggatggaatgaagcctttatccgagaacactttgtgtccggggatgcggaggcaattctttccattccacttccgggaaggcaacaattggataggtggatatggcatttcacagcaaagggggagtacacagtttctagcggctataatttggctatagatctggagttgagagaggaaacagttggcgaaggatctgatatgaaggtgatggagaagatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

195

Amino Acids

21.79

Weight (kDa)

6.92

Isoelectric Point (pI)

28.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 410, 504
AclWI GGATC 1 cut(s) 565
AcsI RAATTY 2 cut(s) 208, 292
AdeI CACNNNGTG 1 cut(s) 397
AfaI GTAC 2 cut(s) 305, 491
AfiI CCNNNNNNNGG 1 cut(s) 437
AgsI TTSAA 3 cut(s) 34, 160, 298
AluBI AGCT 1 cut(s) 342
AluI AGCT 1 cut(s) 342
AlwI GGATC 1 cut(s) 565
ApoI RAATTY 2 cut(s) 208, 292
AsuC2I CCSGG 2 cut(s) 403, 438
AsuHPI GGTGA 2 cut(s) 260, 583
BaeI ACNNNNGTAYC 2 cut(s) 321, 354
BbsI GAAGAC 1 cut(s) 68
BccI CCATC 2 cut(s) 360, 568
BciVI GTATCC 2 cut(s) 270, 322
BcnI CCSGG 2 cut(s) 403, 438
BfaI CTAG 1 cut(s) 501
BfmI CTRYAG 1 cut(s) 519
BfuI GTATCC 2 cut(s) 270, 322
BglII AGATCT 1 cut(s) 523
BisI GCNGC 1 cut(s) 505
BlsI GCNGC 1 cut(s) 506
Bme1390I CCNGG 2 cut(s) 403, 438
BmrFI CCNGG 2 cut(s) 403, 438
BmsI GCATC 1 cut(s) 397
BpiI GAAGAC 1 cut(s) 68
BpmI CTGGAG 2 cut(s) 294, 548
BpuEI CTTGAG 1 cut(s) 24
BpuMI CCSGG 2 cut(s) 403, 438
BsaJI CCNNGG 2 cut(s) 272, 402
BsaXI ACNNNNNCTCC 1 cut(s) 569
Bsc4I CCNNNNNNNGG 1 cut(s) 437
BseDI CCNNGG 2 cut(s) 272, 402
BseGI GGATG 2 cut(s) 371, 412
BseLI CCNNNNNNNGG 1 cut(s) 437
BseMII CTCAG 2 cut(s) 19, 54
BsiSI CCGG 2 cut(s) 402, 437
BslFI GGGAC 2 cut(s) 132, 370
BslI CCNNNNNNNGG 1 cut(s) 437
BsmFI GGGAC 2 cut(s) 132, 370
Bsp143I GATC 2 cut(s) 523, 557
Bsp19I CCATGG 1 cut(s) 272
BspACI CCGC 2 cut(s) 410, 504
BspCNI CTCAG 2 cut(s) 18, 55
BspPI GGATC 1 cut(s) 565
BssECI CCNNGG 2 cut(s) 272, 402
BssMI GATC 2 cut(s) 523, 557
BssT1I CCWWGG 1 cut(s) 272
Bst4CI ACNGT 4 cut(s) 60, 303, 496, 547
BstDEI CTNAG 2 cut(s) 5, 63
BstDSI CCRYGG 1 cut(s) 272
BstF5I GGATG 2 cut(s) 371, 412
BstKTI GATC 2 cut(s) 526, 560
BstMBI GATC 2 cut(s) 523, 557
BstMWI GCNNNNNNNGC 2 cut(s) 94, 320
BstSCI CCNGG 2 cut(s) 401, 436
BstSFI CTRYAG 1 cut(s) 519
BstV2I GAAGAC 1 cut(s) 68
BstX2I RGATCY 2 cut(s) 523, 557
BstYI RGATCY 2 cut(s) 523, 557
BsuI GTATCC 2 cut(s) 270, 322
BtgI CCRYGG 1 cut(s) 272
BtsCI GGATG 2 cut(s) 371, 412
BtsI GCAGTG 1 cut(s) 30
BtsIMutI CAGTG 1 cut(s) 30
Csp6I GTAC 2 cut(s) 304, 490
CviAII CATG 2 cut(s) 104, 273
CviJI RGCY 5 cut(s) 29, 342, 377, 507, 518
CviKI_1 RGCY 5 cut(s) 29, 342, 377, 507, 518
CviQI GTAC 2 cut(s) 304, 490
DdeI CTNAG 2 cut(s) 5, 63
DpnI GATC 2 cut(s) 525, 559
DpnII GATC 2 cut(s) 523, 557
DraIII CACNNNGTG 1 cut(s) 397
Eco130I CCWWGG 1 cut(s) 272
EcoT14I CCWWGG 1 cut(s) 272
ErhI CCWWGG 1 cut(s) 272
FaeI CATG 2 cut(s) 107, 276
FaiI YATR 8 cut(s) 69, 105, 264, 274, 466, 510, 521, 566
FaqI GGGAC 2 cut(s) 132, 370
FatI CATG 2 cut(s) 103, 272
Fnu4HI GCNGC 1 cut(s) 505
FokI GGATG 2 cut(s) 378, 419
Fsp4HI GCNGC 1 cut(s) 505
FspBI CTAG 1 cut(s) 501
GluI GCNGC 1 cut(s) 505
GsuI CTGGAG 2 cut(s) 294, 548
HapII CCGG 2 cut(s) 402, 437
Hin1II CATG 2 cut(s) 107, 276
HindIII AAGCTT 1 cut(s) 340
HpaII CCGG 2 cut(s) 402, 437
HphI GGTGA 2 cut(s) 260, 583
Hpy166II GTNNAC 2 cut(s) 306, 492
Hpy188I TCNGA 3 cut(s) 64, 386, 562
Hpy188III TCNNGA 2 cut(s) 160, 527
Hpy8I GTNNAC 2 cut(s) 306, 492
HpyAV CCTTC 3 cut(s) 435, 548, 562
HpyCH4III ACNGT 4 cut(s) 60, 303, 496, 547
HpyCH4V TGCA 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 2 cut(s) 94, 320
HpyF3I CTNAG 2 cut(s) 5, 63
Hsp92II CATG 2 cut(s) 107, 276
Kzo9I GATC 2 cut(s) 523, 557
LweI GCATC 1 cut(s) 397
MaeI CTAG 1 cut(s) 501
MaeIII GTNAC 2 cut(s) 190, 266
MalI GATC 2 cut(s) 525, 559
MboI GATC 2 cut(s) 523, 557
MboII GAAGA 1 cut(s) 68
MfeI CAATTG 1 cut(s) 449
MflI RGATCY 2 cut(s) 523, 557
MluCI AATT 7 cut(s) 34, 208, 230, 292, 417, 449, 511
MnlI CCTC 4 cut(s) 132, 356, 406, 532
MseI TTAA 1 cut(s) 219
MspI CCGG 2 cut(s) 402, 437
MspR9I CCNGG 2 cut(s) 403, 438
MunI CAATTG 1 cut(s) 449
MwoI GCNNNNNNNGC 2 cut(s) 94, 320
NciI CCSGG 2 cut(s) 403, 438
NcoI CCATGG 1 cut(s) 272
NdeII GATC 2 cut(s) 523, 557
NlaIII CATG 2 cut(s) 107, 276
NmuCI GTSAC 1 cut(s) 266
PfoI TCCNGGA 1 cut(s) 436
PkrI GCNGC 1 cut(s) 506
PsuI RGATCY 2 cut(s) 523, 557
RsaI GTAC 2 cut(s) 305, 491
RsaNI GTAC 2 cut(s) 304, 490
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 1 cut(s) 505
Sau3AI GATC 2 cut(s) 523, 557
ScrFI CCNGG 2 cut(s) 403, 438
SetI ASST 5 cut(s) 179, 289, 344, 461, 573
SfaNI GCATC 1 cut(s) 397
SfcI CTRYAG 1 cut(s) 519
SmlI CTYRAG 1 cut(s) 39
SmoI CTYRAG 1 cut(s) 39
Sse9I AATT 7 cut(s) 34, 208, 230, 292, 417, 449, 511
SsiI CCGC 2 cut(s) 410, 504
SspMI CTAG 1 cut(s) 501
StyD4I CCNGG 2 cut(s) 401, 436
StyI CCWWGG 1 cut(s) 272
TaaI ACNGT 4 cut(s) 60, 303, 496, 547
TasI AATT 7 cut(s) 34, 208, 230, 292, 417, 449, 511
TatI WGTACW 1 cut(s) 489
TauI GCSGC 1 cut(s) 507
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 1 cut(s) 30
TseFI GTSAC 1 cut(s) 266
Tsp45I GTSAC 1 cut(s) 266
TspDTI ATGAA 3 cut(s) 120, 387, 581
TspRI CASTG 1 cut(s) 30
XapI RAATTY 2 cut(s) 208, 292
XspI CTAG 1 cut(s) 501
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.