Rh5AG130500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
13000956 .. 13002233
1278 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG130500.1

Sequence Viewer

Length: 213 bp
ATGGAAAGAGACCAATTTCCCTCAACACAATGGTTTCACTTCCAATTTAGTGACCCCATCAGAGGACAACAACATAGCATGGAGCACGGCTATTGCATCTGGCTTCATTCATGTGTGGCAAGCTCTAACCAGGCAGAAATATGTGGTTCTATAAAGGAAGTTGAAGCAATATTGGAACAAGTGCTACAATTACTCAGGATTTCCATGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

8.2

Weight (kDa)

5.35

Isoelectric Point (pI)

28.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 62
AgsI TTSAA 1 cut(s) 164
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 1 cut(s) 123
AluI AGCT 1 cut(s) 123
Alw21I GWGCWC 1 cut(s) 87
Alw26I GTCTC 1 cut(s) 3
Bbv12I GWGCWC 1 cut(s) 87
BccI CCATC 1 cut(s) 65
BceAI ACGGC 1 cut(s) 103
BciT130I CCWGG 1 cut(s) 131
BcoDI GTCTC 1 cut(s) 3
Bme1390I CCNGG 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 131
BmsI GCATC 1 cut(s) 105
BsaI GGTCTC 1 cut(s) 3
Bsc4I CCNNNNNNNGG 1 cut(s) 62
BseBI CCWGG 1 cut(s) 131
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMII CTCAG 1 cut(s) 208
BsiHKAI GWGCWC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 3
Bso31I GGTCTC 1 cut(s) 3
Bsp1286I GDGCHC 1 cut(s) 87
BspCNI CTCAG 1 cut(s) 207
BspTNI GGTCTC 1 cut(s) 3
Bst2UI CCWGG 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 194
BstMAI GTCTC 1 cut(s) 3
BstNI CCWGG 1 cut(s) 131
BstSCI CCNGG 1 cut(s) 129
Cac8I GCNNGC 1 cut(s) 121
CviAII CATG 3 cut(s) 79, 111, 205
CviJI RGCY 3 cut(s) 90, 103, 123
CviKI_1 RGCY 3 cut(s) 90, 103, 123
DdeI CTNAG 1 cut(s) 194
Eco31I GGTCTC 1 cut(s) 3
EcoRII CCWGG 1 cut(s) 129
FaeI CATG 3 cut(s) 82, 114, 208
FaiI YATR 6 cut(s) 75, 80, 112, 142, 152, 206
FatI CATG 3 cut(s) 78, 110, 204
Hin1II CATG 3 cut(s) 82, 114, 208
Hpy188I TCNGA 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 196
HpyCH4V TGCA 1 cut(s) 96
HpyF3I CTNAG 1 cut(s) 194
Hsp92II CATG 3 cut(s) 82, 114, 208
LmnI GCTCC 1 cut(s) 82
LpnPI CCDG 4 cut(s) 85, 116, 143, 181
LweI GCATC 1 cut(s) 105
MaeIII GTNAC 1 cut(s) 50
MhlI GDGCHC 1 cut(s) 87
MluCI AATT 3 cut(s) 14, 44, 188
MnlI CCTC 2 cut(s) 31, 56
MseI TTAA 1 cut(s) 211
MslI CAYNNNNRTG 1 cut(s) 111
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
NlaIII CATG 3 cut(s) 82, 114, 208
NmuCI GTSAC 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PsrI GAACNNNNNNTAC 2 cut(s) 168, 200
RseI CAYNNNNRTG 1 cut(s) 111
SaqAI TTAA 1 cut(s) 211
ScrFI CCNGG 1 cut(s) 131
SduI GDGCHC 1 cut(s) 87
SetI ASST 1 cut(s) 125
SfaNI GCATC 1 cut(s) 105
SgeI CNNG 9 cut(s) 91, 98, 112, 123, 132, 142, 143, 191, 208
SmiMI CAYNNNNRTG 1 cut(s) 111
Sse9I AATT 3 cut(s) 14, 44, 188
SspI AATATT 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 129
TasI AATT 3 cut(s) 14, 44, 188
Tru1I TTAA 1 cut(s) 211
Tru9I TTAA 1 cut(s) 211
TseFI GTSAC 1 cut(s) 50
Tsp45I GTSAC 1 cut(s) 50
TspDTI ATGAA 2 cut(s) 95, 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.