Rh7AG124200

zinc-binding in reverse transcriptase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
9766108 .. 9766443
336 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG124200.1

Sequence Viewer

Length: 336 bp
ATGTCGTGGGCAGGAGGATGGAATGAAGCCTTTATCCGAGAACACTTTGTGTCCTGGGATGCGAAGGCAATTCTTTCCATTCCACTTCTGGGAAGGCAACAATTGGATAGGTGGATATGGCATTTCACAGCAAAAGGGGAGTACACAGTTTCTAGTGTCTATAATTTGGGTATTGATCTGGAGTTAAGAGATCAAACAGTTGGCGAAGGATCTGATATGAAGGTGATGGAGAAGATGTGGCAAAGGCTGTGGAAACTAAAGGTTCCAGAGAGAGTTAAAATTTTCATGTGGCGGGCTATGAAGGATATTCTCCCATGCAAAGCTAACCTAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

111

Amino Acids

13.14

Weight (kDa)

9.17

Isoelectric Point (pI)

30.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 292
AclWI GGATC 1 cut(s) 217
AcsI RAATTY 1 cut(s) 279
AdeI CACNNNGTG 1 cut(s) 49
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 89
AjnI CCWGG 1 cut(s) 53
AluBI AGCT 1 cut(s) 323
AluI AGCT 1 cut(s) 323
AlwI GGATC 1 cut(s) 217
ApoI RAATTY 1 cut(s) 279
AsuHPI GGTGA 1 cut(s) 235
BccI CCATC 2 cut(s) 12, 220
BciT130I CCWGG 1 cut(s) 55
BfaI CTAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 55
BmiI GGNNCC 1 cut(s) 264
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 200
BsaJI CCNNGG 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 221, 251
Bsc4I CCNNNNNNNGG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 55
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 2 cut(s) 23, 64
BseLI CCNNNNNNNGG 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 89
Bsp143I GATC 3 cut(s) 175, 190, 209
BspACI CCGC 1 cut(s) 292
BspLI GGNNCC 1 cut(s) 264
BspPI GGATC 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 3 cut(s) 175, 190, 209
Bst2UI CCWGG 1 cut(s) 55
Bst4CI ACNGT 2 cut(s) 148, 199
BstC8I GCNNGC 1 cut(s) 294
BstF5I GGATG 2 cut(s) 23, 64
BstKTI GATC 3 cut(s) 178, 193, 212
BstMBI GATC 3 cut(s) 175, 190, 209
BstNI CCWGG 1 cut(s) 55
BstSCI CCNGG 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 209
BstYI RGATCY 1 cut(s) 209
BtsCI GGATG 2 cut(s) 23, 64
Cac8I GCNNGC 1 cut(s) 294
Csp6I GTAC 1 cut(s) 142
CspCI CAANNNNNGTGG 2 cut(s) 230, 265
CviAII CATG 2 cut(s) 286, 315
CviJI RGCY 4 cut(s) 29, 247, 296, 323
CviKI_1 RGCY 4 cut(s) 29, 247, 296, 323
CviQI GTAC 1 cut(s) 142
DpnI GATC 3 cut(s) 177, 192, 211
DpnII GATC 3 cut(s) 175, 190, 209
DraIII CACNNNGTG 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 53
FaeI CATG 2 cut(s) 289, 318
FaiI YATR 6 cut(s) 118, 162, 218, 287, 299, 316
FatI CATG 2 cut(s) 285, 314
FauI CCCGC 1 cut(s) 285
FokI GGATG 2 cut(s) 30, 71
FspBI CTAG 1 cut(s) 153
GsuI CTGGAG 1 cut(s) 200
Hin1II CATG 2 cut(s) 289, 318
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 38, 214
Hpy188III TCNNGA 2 cut(s) 179, 266
Hpy8I GTNNAC 1 cut(s) 144
HpyAV CCTTC 5 cut(s) 58, 87, 200, 214, 295
HpyCH4III ACNGT 2 cut(s) 148, 199
HpyCH4V TGCA 1 cut(s) 318
Hsp92II CATG 2 cut(s) 289, 318
Kzo9I GATC 3 cut(s) 175, 190, 209
LpnPI CCDG 5 cut(s) 40, 67, 74, 164, 279
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 153
MalI GATC 3 cut(s) 177, 192, 211
MboI GATC 3 cut(s) 175, 190, 209
MboII GAAGA 1 cut(s) 244
MfeI CAATTG 1 cut(s) 101
MflI RGATCY 1 cut(s) 209
MluCI AATT 5 cut(s) 69, 101, 163, 279, 331
MnlI CCTC 1 cut(s) 8
MseI TTAA 2 cut(s) 185, 276
MspR9I CCNGG 1 cut(s) 55
MunI CAATTG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 55
NdeII GATC 3 cut(s) 175, 190, 209
NlaIII CATG 2 cut(s) 289, 318
NlaIV GGNNCC 1 cut(s) 264
Psp6I CCWGG 1 cut(s) 53
PspGI CCWGG 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 264
PsuI RGATCY 1 cut(s) 209
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 2 cut(s) 185, 276
Sau3AI GATC 3 cut(s) 175, 190, 209
ScrFI CCNGG 1 cut(s) 55
SetI ASST 5 cut(s) 113, 225, 264, 325, 330
SfaNI GCATC 1 cut(s) 49
Sse9I AATT 5 cut(s) 69, 101, 163, 279, 331
SsiI CCGC 1 cut(s) 292
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 53
TaaI ACNGT 2 cut(s) 148, 199
TasI AATT 5 cut(s) 69, 101, 163, 279, 331
TatI WGTACW 1 cut(s) 141
Tru1I TTAA 2 cut(s) 185, 276
Tru9I TTAA 2 cut(s) 185, 276
TspDTI ATGAA 4 cut(s) 39, 233, 274, 314
XapI RAATTY 1 cut(s) 279
XcmI CCANNNNNNNNNTGG 1 cut(s) 85
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.