Rh7DG127800

zinc-binding in reverse transcriptase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
10764537 .. 10764776
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG127800.1

Sequence Viewer

Length: 240 bp
ATGTCGGGGGCAGGAGAATGGAATGAAGCCTTTATCCGAGAACACTTTGTGTCCGGGGATGCGGAGGCAATTCTTTCCATTCCACTTCTGGGAAGGCAACAATTGGATAGGTGGATATGGCATTTCACAGCAAAGGGGGAGTACACAGTTTCTAGTGGCTATAATTTGGCTATAGATCTGGAGTTGAGAGAGGAAACAGTTGGCGAAGGATCTGATATGAAGGTGATGGAGAAAATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

79

Amino Acids

8.95

Weight (kDa)

4.6

Isoelectric Point (pI)

31.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 62
AclWI GGATC 1 cut(s) 217
AdeI CACNNNGTG 1 cut(s) 49
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 89
AlwI GGATC 1 cut(s) 217
AsuC2I CCSGG 1 cut(s) 55
AsuHPI GGTGA 1 cut(s) 235
BccI CCATC 1 cut(s) 220
BcnI CCSGG 1 cut(s) 55
BfaI CTAG 1 cut(s) 153
BfmI CTRYAG 1 cut(s) 171
BglII AGATCT 1 cut(s) 175
Bme1390I CCNGG 1 cut(s) 55
BmrFI CCNGG 1 cut(s) 55
BmsI GCATC 1 cut(s) 49
BpmI CTGGAG 1 cut(s) 200
BpuMI CCSGG 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 54
BsaXI ACNNNNNCTCC 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 54
BseGI GGATG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 89
BsiSI CCGG 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 89
Bsp143I GATC 2 cut(s) 175, 209
BspACI CCGC 1 cut(s) 62
BspPI GGATC 1 cut(s) 217
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 2 cut(s) 175, 209
Bst4CI ACNGT 2 cut(s) 148, 199
BstF5I GGATG 1 cut(s) 64
BstKTI GATC 2 cut(s) 178, 212
BstMBI GATC 2 cut(s) 175, 209
BstSCI CCNGG 1 cut(s) 53
BstSFI CTRYAG 1 cut(s) 171
BstX2I RGATCY 2 cut(s) 175, 209
BstYI RGATCY 2 cut(s) 175, 209
BtsCI GGATG 1 cut(s) 64
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 3 cut(s) 29, 159, 170
CviKI_1 RGCY 3 cut(s) 29, 159, 170
CviQI GTAC 1 cut(s) 142
DpnI GATC 2 cut(s) 177, 211
DpnII GATC 2 cut(s) 175, 209
DraIII CACNNNGTG 1 cut(s) 49
FaiI YATR 4 cut(s) 118, 162, 173, 218
FokI GGATG 1 cut(s) 71
FspBI CTAG 1 cut(s) 153
GsuI CTGGAG 1 cut(s) 200
HapII CCGG 1 cut(s) 54
HpaII CCGG 1 cut(s) 54
HphI GGTGA 1 cut(s) 235
Hpy166II GTNNAC 1 cut(s) 144
Hpy188I TCNGA 2 cut(s) 38, 214
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 144
HpyAV CCTTC 3 cut(s) 87, 200, 214
HpyCH4III ACNGT 2 cut(s) 148, 199
Kzo9I GATC 2 cut(s) 175, 209
LpnPI CCDG 3 cut(s) 67, 74, 164
LweI GCATC 1 cut(s) 49
MaeI CTAG 1 cut(s) 153
MalI GATC 2 cut(s) 177, 211
MboI GATC 2 cut(s) 175, 209
MfeI CAATTG 1 cut(s) 101
MflI RGATCY 2 cut(s) 175, 209
MluCI AATT 3 cut(s) 69, 101, 163
MnlI CCTC 2 cut(s) 58, 184
MspI CCGG 1 cut(s) 54
MspR9I CCNGG 1 cut(s) 55
MunI CAATTG 1 cut(s) 101
NciI CCSGG 1 cut(s) 55
NdeII GATC 2 cut(s) 175, 209
PsuI RGATCY 2 cut(s) 175, 209
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
Sau3AI GATC 2 cut(s) 175, 209
ScrFI CCNGG 1 cut(s) 55
SetI ASST 2 cut(s) 113, 225
SfaNI GCATC 1 cut(s) 49
SfcI CTRYAG 1 cut(s) 171
SgeI CNNG 8 cut(s) 18, 24, 50, 66, 67, 101, 165, 191
Sse9I AATT 3 cut(s) 69, 101, 163
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 1 cut(s) 53
TaaI ACNGT 2 cut(s) 148, 199
TasI AATT 3 cut(s) 69, 101, 163
TatI WGTACW 1 cut(s) 141
TspDTI ATGAA 2 cut(s) 39, 233
XcmI CCANNNNNNNNNTGG 1 cut(s) 85
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.