Rmu_sc0002242.1_g000010

START domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002242.1
Physical Location & Seq
Reverse (-)
35098 .. 36713
1616 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002242.1_g000010.1.cds

Sequence Viewer

Length: 888 bp
atgaaagatggaggtccggcttggatacatatgatggatcgctcaactccaactatggcctaccaagcttggcgtagggatccaaagattggtcctcctcaatatcgtaacaggactgtgtatgaggatgcaacaccggagctagtgagggactttttctgggatgatgagttccggttaaggtgggacaacatgcttagtgatgccacaaccttagatgagtgcccaaccacaggaaccatggttgttcagtggataaagaagttcccgttcttctgtaaagacagggaatacataataggacgtcgaatttgggagtcaggaaggaagtattattgtgtgacaaagggagtaccctatccttctattcaaaggcatgacaaaccaagacgtgtggatcactactactcaagttggtgcattcaagcagtggaatcaagacacggcaatggccagctgactgcatgtgaagttcaactgtttcatcaagaggaaacgggaatcccatgggaaattgcaaaacttgctgtacgaaaaggattgtgggatactgtaaagaacatagagtctggtttacgtgcttaccagaaagagagagcgttaggtggaataatttctcggcctgcctttctggctcagatcaacaccaaaataaatctagagtacctgaaagcctccgctggcactgaggattcgtcacaaactgcagtggtgactacatctgacaaacctttcagtgggaacatacggaatctcataattgttggtgggagtattctccttgcatgcactcttgaccgggggtttctggtgaagacagtaatattcggtgtggccgatgtggccaggaagtttgcaaatgtagggaagaagtcaaaaccaaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

295

Amino Acids

33.75

Weight (kDa)

9.35

Isoelectric Point (pI)

43.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 307
AccB7I CCANNNNNTGG 1 cut(s) 89
AciI CCGC 1 cut(s) 678
AclWI GGATC 4 cut(s) 45, 74, 87, 405
AcoI YGGCCR 3 cut(s) 451, 834, 843
AcsI RAATTY 1 cut(s) 309
AcyI GRCGYC 1 cut(s) 304
AfaI GTAC 3 cut(s) 354, 531, 665
AfiI CCNNNNNNNGG 3 cut(s) 89, 233, 737
AflIII ACRYGT 1 cut(s) 391
AgsI TTSAA 3 cut(s) 371, 425, 476
AjiI CACGTC 1 cut(s) 392
AjnI CCWGG 1 cut(s) 845
AloI GAACNNNNNNTCC 2 cut(s) 155, 187
AluBI AGCT 3 cut(s) 68, 142, 457
AluI AGCT 3 cut(s) 68, 142, 457
AlwI GGATC 4 cut(s) 45, 74, 87, 405
AoxI GGCC 5 cut(s) 57, 451, 620, 834, 843
ApoI RAATTY 1 cut(s) 309
ArsI GACNNNNNNTTYG 2 cut(s) 294, 326
Asp700I GAANNNNTTC 1 cut(s) 613
AspS9I GGNCC 2 cut(s) 14, 92
AsuC2I CCSGG 1 cut(s) 800
AsuHPI GGTGA 2 cut(s) 724, 823
AvaII GGWCC 2 cut(s) 14, 92
BaeGI GKGCMC 1 cut(s) 227
BalI TGGCCA 2 cut(s) 453, 845
BamHI GGATCC 1 cut(s) 79
BbsI GAAGAC 1 cut(s) 821
BccI CCATC 2 cut(s) 2, 28
BceAI ACGGC 1 cut(s) 460
BciT130I CCWGG 1 cut(s) 847
BciVI GTATCC 2 cut(s) 18, 541
BcnI CCSGG 1 cut(s) 800
BfaI CTAG 2 cut(s) 143, 659
BfmI CTRYAG 1 cut(s) 705
BfuI GTATCC 2 cut(s) 18, 541
BglI GCCNNNNNGGC 2 cut(s) 632, 842
Bme1390I CCNGG 2 cut(s) 800, 847
Bme18I GGWCC 2 cut(s) 14, 92
BmgBI CACGTC 1 cut(s) 392
BmgT120I GGNCC 2 cut(s) 14, 92
BmiI GGNNCC 2 cut(s) 81, 238
BmrFI CCNGG 2 cut(s) 800, 847
BmsI GCATC 2 cut(s) 118, 193
BpiI GAAGAC 1 cut(s) 821
BpuEI CTTGAG 1 cut(s) 394
BpuMI CCSGG 1 cut(s) 800
BsaAI YACGTR 1 cut(s) 578
BsaHI GRCGYC 1 cut(s) 304
BsaJI CCNNGG 3 cut(s) 240, 506, 799
BsaWI WCCGGW 2 cut(s) 136, 174
Bsc4I CCNNNNNNNGG 3 cut(s) 89, 233, 737
Bse3DI GCAATG 1 cut(s) 454
BseBI CCWGG 1 cut(s) 847
BseDI CCNNGG 3 cut(s) 240, 506, 799
BseGI GGATG 2 cut(s) 133, 169
BseLI CCNNNNNNNGG 3 cut(s) 89, 233, 737
BseMI GCAATG 1 cut(s) 454
BseMII CTCAG 2 cut(s) 650, 678
BseRI GAGGAG 1 cut(s) 87
BseSI GKGCMC 1 cut(s) 227
BshFI GGCC 5 cut(s) 59, 453, 622, 836, 845
BsiSI CCGG 4 cut(s) 17, 137, 175, 799
BslFI GGGAC 2 cut(s) 164, 200
BslI CCNNNNNNNGG 3 cut(s) 89, 233, 737
BsmFI GGGAC 2 cut(s) 164, 200
BsmI GAATGC 1 cut(s) 420
BsnI GGCC 5 cut(s) 59, 453, 622, 836, 845
Bsp1286I GDGCHC 1 cut(s) 227
Bsp143I GATC 4 cut(s) 37, 79, 397, 639
Bsp19I CCATGG 2 cut(s) 240, 506
BspACI CCGC 1 cut(s) 678
BspANI GGCC 5 cut(s) 59, 453, 622, 836, 845
BspCNI CTCAG 2 cut(s) 649, 679
BspLI GGNNCC 2 cut(s) 81, 238
BspMAI CTGCAG 1 cut(s) 709
BspPI GGATC 4 cut(s) 45, 74, 87, 405
BsrDI GCAATG 1 cut(s) 454
BssECI CCNNGG 3 cut(s) 240, 506, 799
BssMI GATC 4 cut(s) 37, 79, 397, 639
BssNI GRCGYC 1 cut(s) 304
BssT1I CCWWGG 2 cut(s) 240, 506
Bst2UI CCWGG 1 cut(s) 847
Bst4CI ACNGT 4 cut(s) 118, 480, 553, 820
BstACI GRCGYC 1 cut(s) 304
BstAPI GCANNNNNTGC 1 cut(s) 524
BstBAI YACGTR 1 cut(s) 578
BstC8I GCNNGC 4 cut(s) 455, 624, 682, 787
BstDEI CTNAG 4 cut(s) 197, 214, 636, 687
BstDSI CCRYGG 2 cut(s) 240, 506
BstF5I GGATG 2 cut(s) 133, 169
BstKTI GATC 4 cut(s) 40, 82, 400, 642
BstMBI GATC 4 cut(s) 37, 79, 397, 639
BstMWI GCNNNNNNNGC 4 cut(s) 65, 524, 632, 842
BstNI CCWGG 1 cut(s) 847
BstNSI RCATGY 3 cut(s) 196, 468, 789
BstSCI CCNGG 2 cut(s) 798, 845
BstSFI CTRYAG 1 cut(s) 705
BstSLI GKGCMC 1 cut(s) 227
BstV2I GAAGAC 1 cut(s) 821
BstX2I RGATCY 1 cut(s) 79
BstYI RGATCY 1 cut(s) 79
BsuI GTATCC 2 cut(s) 18, 541
BsuRI GGCC 5 cut(s) 59, 453, 622, 836, 845
BtgI CCRYGG 2 cut(s) 240, 506
BtrI CACGTC 1 cut(s) 392
BtsCI GGATG 2 cut(s) 133, 169
BtsI GCAGTG 2 cut(s) 435, 714
BtsIMutI CAGTG 5 cut(s) 257, 435, 684, 714, 742
Cac8I GCNNGC 4 cut(s) 455, 624, 682, 787
Cfr13I GGNCC 2 cut(s) 14, 92
Csp6I GTAC 3 cut(s) 353, 530, 664
CspCI CAANNNNNGTGG 2 cut(s) 375, 410
CviAII CATG 6 cut(s) 193, 241, 377, 465, 507, 786
CviQI GTAC 3 cut(s) 353, 530, 664
DdeI CTNAG 4 cut(s) 197, 214, 636, 687
DpnI GATC 4 cut(s) 39, 81, 399, 641
DpnII GATC 4 cut(s) 37, 79, 397, 639
EaeI YGGCCR 3 cut(s) 451, 834, 843
Eco130I CCWWGG 2 cut(s) 240, 506
Eco47I GGWCC 2 cut(s) 14, 92
EcoRII CCWGG 1 cut(s) 845
EcoT14I CCWWGG 2 cut(s) 240, 506
ErhI CCWWGG 2 cut(s) 240, 506
FaeI CATG 6 cut(s) 196, 244, 380, 468, 510, 789
FaqI GGGAC 2 cut(s) 164, 200
FatI CATG 6 cut(s) 192, 240, 376, 464, 506, 785
FauNDI CATATG 1 cut(s) 30
FokI GGATG 2 cut(s) 140, 176
FspBI CTAG 2 cut(s) 143, 659
HaeIII GGCC 5 cut(s) 59, 453, 622, 836, 845
HapII CCGG 4 cut(s) 17, 137, 175, 799
Hin1I GRCGYC 1 cut(s) 304
Hin1II CATG 6 cut(s) 196, 244, 380, 468, 510, 789
HindIII AAGCTT 1 cut(s) 66
HinfI GANTC 6 cut(s) 317, 434, 501, 566, 692, 751
HpaII CCGG 4 cut(s) 17, 137, 175, 799
HphI GGTGA 2 cut(s) 724, 823
Hpy166II GTNNAC 1 cut(s) 575
Hpy188I TCNGA 2 cut(s) 639, 724
Hpy188III TCNNGA 5 cut(s) 321, 438, 488, 659, 794
Hpy8I GTNNAC 1 cut(s) 575
Hpy99I CGWCG 1 cut(s) 309
HpyAV CCTTC 2 cut(s) 318, 372
HpyCH4III ACNGT 4 cut(s) 118, 480, 553, 820
HpyCH4IV ACGT 3 cut(s) 304, 391, 577
HpyCH4V TGCA 8 cut(s) 131, 420, 464, 518, 707, 785, 789, 857
HpyF10VI GCNNNNNNNGC 4 cut(s) 65, 524, 632, 842
HpyF3I CTNAG 4 cut(s) 197, 214, 636, 687
HpySE526I ACGT 3 cut(s) 304, 391, 577
Hsp92I GRCGYC 1 cut(s) 304
Hsp92II CATG 6 cut(s) 196, 244, 380, 468, 510, 789
Kzo9I GATC 4 cut(s) 37, 79, 397, 639
LmnI GCTCC 1 cut(s) 139
LweI GCATC 2 cut(s) 118, 193
MaeI CTAG 2 cut(s) 143, 659
MaeII ACGT 3 cut(s) 304, 391, 577
MaeIII GTNAC 4 cut(s) 107, 340, 696, 712
MalI GATC 4 cut(s) 39, 81, 399, 641
MboI GATC 4 cut(s) 37, 79, 397, 639
MboII GAAGA 3 cut(s) 265, 826, 880
MflI RGATCY 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 227
MlsI TGGCCA 2 cut(s) 453, 845
MluCI AATT 4 cut(s) 309, 513, 612, 759
MluNI TGGCCA 2 cut(s) 453, 845
MlyI GAGTC 2 cut(s) 326, 575
MmeI TCCRAC 1 cut(s) 74
MnlI CCTC 8 cut(s) 5, 105, 108, 118, 141, 484, 682, 685
Mox20I TGGCCA 2 cut(s) 453, 845
MroXI GAANNNNTTC 1 cut(s) 613
MscI TGGCCA 2 cut(s) 453, 845
MseI TTAA 1 cut(s) 179
MslI CAYNNNNRTG 1 cut(s) 447
Msp20I TGGCCA 2 cut(s) 453, 845
MspA1I CMGCKG 2 cut(s) 457, 680
MspI CCGG 4 cut(s) 17, 137, 175, 799
MspR9I CCNGG 2 cut(s) 800, 847
Mva1269I GAATGC 1 cut(s) 420
MvaI CCWGG 1 cut(s) 847
MwoI GCNNNNNNNGC 4 cut(s) 65, 524, 632, 842
NciI CCSGG 1 cut(s) 800
NcoI CCATGG 2 cut(s) 240, 506
NdeI CATATG 1 cut(s) 30
NdeII GATC 4 cut(s) 37, 79, 397, 639
NlaIII CATG 6 cut(s) 196, 244, 380, 468, 510, 789
NlaIV GGNNCC 2 cut(s) 81, 238
NmeAIII GCCGAG 1 cut(s) 598
NmuCI GTSAC 3 cut(s) 340, 696, 712
NspI RCATGY 3 cut(s) 196, 468, 789
PaeI GCATGC 1 cut(s) 789
PcsI WCGNNNNNNNCGW 1 cut(s) 834
PctI GAATGC 1 cut(s) 420
PdmI GAANNNNTTC 1 cut(s) 613
PfeI GAWTC 4 cut(s) 434, 501, 692, 751
PflMI CCANNNNNTGG 1 cut(s) 89
PleI GAGTC 2 cut(s) 325, 574
PpsI GAGTC 2 cut(s) 325, 574
Ppu21I YACGTR 1 cut(s) 578
Psp6I CCWGG 1 cut(s) 845
PspGI CCWGG 1 cut(s) 845
PspN4I GGNNCC 2 cut(s) 81, 238
PspPI GGNCC 2 cut(s) 14, 92
PstI CTGCAG 1 cut(s) 709
PsuI RGATCY 1 cut(s) 79
PvuII CAGCTG 1 cut(s) 457
RsaI GTAC 3 cut(s) 354, 531, 665
RsaNI GTAC 3 cut(s) 353, 530, 664
RseI CAYNNNNRTG 1 cut(s) 447
SaqAI TTAA 1 cut(s) 179
Sau3AI GATC 4 cut(s) 37, 79, 397, 639
Sau96I GGNCC 2 cut(s) 14, 92
SchI GAGTC 2 cut(s) 326, 575
ScrFI CCNGG 2 cut(s) 800, 847
SduI GDGCHC 1 cut(s) 227
SfaNI GCATC 2 cut(s) 118, 193
SfcI CTRYAG 1 cut(s) 705
SfiI GGCCNNNNNGGCC 1 cut(s) 842
SinI GGWCC 2 cut(s) 14, 92
SmiMI CAYNNNNRTG 1 cut(s) 447
SmlI CTYRAG 1 cut(s) 409
SmoI CTYRAG 1 cut(s) 409
SphI GCATGC 1 cut(s) 789
Sse9I AATT 4 cut(s) 309, 513, 612, 759
SsiI CCGC 1 cut(s) 678
SspI AATATT 1 cut(s) 825
SspMI CTAG 2 cut(s) 143, 659
StyD4I CCNGG 2 cut(s) 798, 845
StyI CCWWGG 2 cut(s) 240, 506
TaaI ACNGT 4 cut(s) 118, 480, 553, 820
TaiI ACGT 3 cut(s) 307, 394, 580
TaqI TCGA 1 cut(s) 307
TasI AATT 4 cut(s) 309, 513, 612, 759
TfiI GAWTC 4 cut(s) 434, 501, 692, 751
Tru1I TTAA 1 cut(s) 179
Tru9I TTAA 1 cut(s) 179
TscAI CASTG 5 cut(s) 257, 435, 691, 714, 742
TseFI GTSAC 3 cut(s) 340, 696, 712
Tsp45I GTSAC 3 cut(s) 340, 696, 712
TspDTI ATGAA 2 cut(s) 17, 473
TspGWI ACGGA 1 cut(s) 763
TspRI CASTG 5 cut(s) 257, 435, 691, 714, 742
Van91I CCANNNNNTGG 1 cut(s) 89
VpaK11BI GGWCC 2 cut(s) 14, 92
XapI RAATTY 1 cut(s) 309
XbaI TCTAGA 1 cut(s) 658
XceI RCATGY 3 cut(s) 196, 468, 789
XcmI CCANNNNNNNNNTGG 1 cut(s) 238
XmnI GAANNNNTTC 1 cut(s) 613
XspI CTAG 2 cut(s) 143, 659
ZraI GACGTC 1 cut(s) 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.