Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002621.1

Orthogroup ID

OG0002487

Physical Location & Seq

Genomic Coordinates Reverse (-)

81482 .. 84839

Gene Structure 3358 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002621.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1113 bp

atggccgccggagtttggacagagccgccgccgaccaccgccaatggtgtcggggccatgctgctccgcttcgactcatcaagtccaaccactttcctaactagcacaaagtctgaaaatgaatggaagtggtcgaaacaacttcaagtcgaactcactagttcaagaataaatcaaaacgatgcactacatctcgagatatcacgatcgaaaggttttggttttcgatcgaaaaccggtcgagctccgacgaacgtgaaaccggagaaaaccggcgttgactcaaatcgaactcaaatcggaacgagcttgccgccgccgctacaggccgtgccaccgttcaaggtcagcacatacgggtgcgcaaagaccatacgaagccaatggaagaagtttggtgaggattggtggccggaggaggaaaatatggcttggagaagtttggaggcgatttccggcctctggaggaaacctgcagccggtttccatttttggaaatttctgaaaatattttcggaaatttccgaaaatggaagctttatactaaattggaaacgttttcaaaaaatcataactaattcatacgaactccgatttttatgttccgtatatgcacgcgatcgtatcgacgagctctacaactttcatgaaggaagttttcccaaattcgtaagtcaggtaaggagggatttgaggcttttacaatcaactaagttggaggagattttgggctgctgcttccaaagtatcactggaacgagacccaagcaaaaggtgcatctattagaaagtttgaagagaagaaaatgtgaaagtggaaaatataatttcatggaacgacttctgggagctgcacgtcttttatcacaggtgtttcttgcttcatcatatgaacttagttttgtcctctttaattgcacttctagtatggttaacattgtattattcactatcatattcatgtcttcagggagttttaccctaccacaagaggattttatcactctggagtgcgtgtggaaatctaataaatttgacttgcttgagaggacacaaaagagccagattgcagtgtcagggcacacttctgcggcgggtaggtttgcgttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4477

Protein Analysis

370

Amino Acids

42.25

Weight (kDa)

9.55

Isoelectric Point (pI)

50.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002487)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G50910 AT1G50910
fragaria_vesca	FvH4_3g22120 FvH4_3g22120
malus_domestica	MD03G1208200.v1.1 MD11G1222400.v1.1
prunus_persica	Prupe.4G208500_v2.0.a1
pyrus_communis	pycom11g19620
rosa_chinensis	RchiOBHm_Chr1g0330851 RchiOBHm_Chr5g0037971
rosa_laevigata	RLG00000022534 RLG00000029769 RLG00000029772 RLG00000029783 RLG00000033828
rosa_multiflora	Rmu_sc0002621.1_g000008 Rmu_sc0002621.1_g000015 Rmu_sc0002670.1_g000013 Rmu_sc0002899.1_g000005 Rmu_sc0010964.1_g000001
rosa_roxburghii	Rroxscaffold_4G00319700
rosa_rugosa	Rorug01G0090700 Rorug05G0169800
rosa_samantha	Rh1AG112300 Rh1BG086400 Rh1BG114800 Rh1CG107700 Rh1CG109400 Rh1DG117800 Rh3BG367100 Rh3BG367300 Rh5AG258000 Rh5BG261000 Rh5CG293300 Rh5DG270200 Rh6BG121000 Rh6BG268100 Rh6CG119300
rosa_wichuraiana	Rw1G009090 Rw5G023910 Rw5G024090

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	364
Acc36I	ACCTGC	1 cut(s)	481
AccII	CGCG	1 cut(s)	618
AclI	AACGTT	1 cut(s)	556
AcoI	YGGCCR	2 cut(s)	3, 410
AcsI	RAATTY	4 cut(s)	497, 519, 665, 1031
AcuI	CTGAAG	1 cut(s)	951
AfiI	CCNNNNNNNGG	3 cut(s)	15, 462, 479
AgeI	ACCGGT	1 cut(s)	236
AgsI	TTSAA	5 cut(s)	146, 165, 343, 563, 796
AhlI	ACTAGT	1 cut(s)	158
AjiI	CACGTC	1 cut(s)	857
AluBI	AGCT	5 cut(s)	245, 309, 537, 634, 851
AluI	AGCT	5 cut(s)	245, 309, 537, 634, 851
Alw21I	GWGCWC	2 cut(s)	247, 636
Alw26I	GTCTC	1 cut(s)	754
Ama87I	CYCGRG	1 cut(s)	194
AoxI	GGCC	5 cut(s)	3, 54, 327, 410, 457
ApeKI	GCWGC	5 cut(s)	61, 476, 732, 735, 851
ApoI	RAATTY	4 cut(s)	497, 519, 665, 1031
AsiGI	ACCGGT	1 cut(s)	236
Asp700I	GAANNNNTTC	1 cut(s)	840
AspLEI	GCGC	1 cut(s)	365
AspS9I	GGNCC	1 cut(s)	54
AsuHPI	GGTGA	1 cut(s)	410
AvaI	CYCGRG	1 cut(s)	194
BaeGI	GKGCMC	1 cut(s)	1083
BanII	GRGCYC	2 cut(s)	247, 636
BbsI	GAAGAC	1 cut(s)	957
Bbv12I	GWGCWC	2 cut(s)	247, 636
BbvI	GCAGC	5 cut(s)	48, 488, 719, 722, 838
BceAI	ACGGC	1 cut(s)	314
BcoDI	GTCTC	1 cut(s)	754
BcuI	ACTAGT	1 cut(s)	158
BfaI	CTAG	3 cut(s)	102, 159, 924
BfmI	CTRYAG	2 cut(s)	323, 474
BfuAI	ACCTGC	1 cut(s)	481
BmeT110I	CYCGRG	1 cut(s)	194
BmgBI	CACGTC	1 cut(s)	857
BmgT120I	GGNCC	1 cut(s)	54
BmiI	GGNNCC	1 cut(s)	55
BmsI	GCATC	2 cut(s)	172, 787
BpiI	GAAGAC	1 cut(s)	957
BpmI	CTGGAG	2 cut(s)	484, 1028
BpuEI	CTTGAG	1 cut(s)	1064
BsaI	GGTCTC	1 cut(s)	754
BsaWI	WCCGGW	2 cut(s)	236, 262
BsaXI	ACNNNNNCTCC	2 cut(s)	1001, 1031
Bsc4I	CCNNNNNNNGG	3 cut(s)	15, 462, 479
Bse118I	RCCGGY	3 cut(s)	236, 272, 479
Bse1I	ACTGG	1 cut(s)	757
BseLI	CCNNNNNNNGG	3 cut(s)	15, 462, 479
BseNI	ACTGG	1 cut(s)	757
BseRI	GAGGAG	2 cut(s)	431, 734
BseSI	GKGCMC	1 cut(s)	1083
BseXI	GCAGC	5 cut(s)	48, 488, 719, 722, 838
BsgI	GTGCAG	1 cut(s)	837
Bsh1236I	CGCG	1 cut(s)	618
Bsh1285I	CGRYCG	4 cut(s)	209, 230, 241, 622
BshFI	GGCC	5 cut(s)	5, 56, 329, 412, 459
BshTI	ACCGGT	1 cut(s)	236
BsiEI	CGRYCG	4 cut(s)	209, 230, 241, 622
BsiHKAI	GWGCWC	2 cut(s)	247, 636
BsiHKCI	CYCGRG	1 cut(s)	194
BsiSI	CCGG	7 cut(s)	9, 237, 263, 273, 413, 456, 480
BslI	CCNNNNNNNGG	3 cut(s)	15, 462, 479
BsmAI	GTCTC	1 cut(s)	754
BsnI	GGCC	5 cut(s)	5, 56, 329, 412, 459
Bso31I	GGTCTC	1 cut(s)	754
BsoBI	CYCGRG	1 cut(s)	194
Bsp1286I	GDGCHC	3 cut(s)	247, 636, 1083
Bsp143I	GATC	3 cut(s)	206, 227, 619
BspANI	GGCC	5 cut(s)	5, 56, 329, 412, 459
BspFNI	CGCG	1 cut(s)	618
BspHI	TCATGA	1 cut(s)	646
BspLI	GGNNCC	1 cut(s)	55
BspMAI	CTGCAG	1 cut(s)	478
BspMI	ACCTGC	1 cut(s)	481
BspTNI	GGTCTC	1 cut(s)	754
BsrFI	RCCGGY	3 cut(s)	236, 272, 479
BsrI	ACTGG	1 cut(s)	757
BssAI	RCCGGY	3 cut(s)	236, 272, 479
BssMI	GATC	3 cut(s)	206, 227, 619
Bst4CI	ACNGT	1 cut(s)	339
Bst6I	CTCTTC	1 cut(s)	791
BstAPI	GCANNNNNTGC	1 cut(s)	775
BstC8I	GCNNGC	2 cut(s)	311, 616
BstDEI	CTNAG	2 cut(s)	711, 896
BstFNI	CGCG	1 cut(s)	618
BstHHI	GCGC	1 cut(s)	365
BstKTI	GATC	3 cut(s)	209, 230, 622
BstMAI	GTCTC	1 cut(s)	754
BstMBI	GATC	3 cut(s)	206, 227, 619
BstMCI	CGRYCG	4 cut(s)	209, 230, 241, 622
BstMWI	GCNNNNNNNGC	2 cut(s)	319, 775
BstSFI	CTRYAG	2 cut(s)	323, 474
BstSLI	GKGCMC	1 cut(s)	1083
BstUI	CGCG	1 cut(s)	618
BstV1I	GCAGC	5 cut(s)	48, 488, 719, 722, 838
BstV2I	GAAGAC	1 cut(s)	957
BsuRI	GGCC	5 cut(s)	5, 56, 329, 412, 459
BtrI	CACGTC	1 cut(s)	857
BtsI	GCAGTG	1 cut(s)	1077
BtsIMutI	CAGTG	2 cut(s)	750, 1077
BveI	ACCTGC	1 cut(s)	481
Cac8I	GCNNGC	2 cut(s)	311, 616
CciI	TCATGA	1 cut(s)	646
CfoI	GCGC	1 cut(s)	365
Cfr10I	RCCGGY	3 cut(s)	236, 272, 479
Cfr13I	GGNCC	1 cut(s)	54
CspAI	ACCGGT	1 cut(s)	236
CviAII	CATG	4 cut(s)	58, 647, 832, 961
DdeI	CTNAG	2 cut(s)	711, 896
DpnI	GATC	3 cut(s)	208, 229, 621
DpnII	GATC	3 cut(s)	206, 227, 619
EaeI	YGGCCR	2 cut(s)	3, 410
Eam1104I	CTCTTC	1 cut(s)	791
EarI	CTCTTC	1 cut(s)	791
Ecl136II	GAGCTC	2 cut(s)	245, 634
Eco24I	GRGCYC	2 cut(s)	247, 636
Eco31I	GGTCTC	1 cut(s)	754
Eco32I	GATATC	1 cut(s)	201
Eco53kI	GAGCTC	2 cut(s)	245, 634
Eco57I	CTGAAG	1 cut(s)	951
Eco88I	CYCGRG	1 cut(s)	194
EcoICRI	GAGCTC	2 cut(s)	245, 634
EcoRV	GATATC	1 cut(s)	201
EcoT38I	GRGCYC	2 cut(s)	247, 636
FaeI	CATG	4 cut(s)	61, 650, 835, 964
FatI	CATG	4 cut(s)	57, 646, 831, 960
FauI	CCCGC	1 cut(s)	1087
FauNDI	CATATG	1 cut(s)	889
FriOI	GRGCYC	2 cut(s)	247, 636
FspBI	CTAG	3 cut(s)	102, 159, 924
FspI	TGCGCA	1 cut(s)	364
GlaI	GCGC	1 cut(s)	364
GsuI	CTGGAG	2 cut(s)	484, 1028
HaeIII	GGCC	5 cut(s)	5, 56, 329, 412, 459
HapII	CCGG	7 cut(s)	9, 237, 263, 273, 413, 456, 480
HhaI	GCGC	1 cut(s)	365
Hin1II	CATG	4 cut(s)	61, 650, 835, 964
Hin6I	GCGC	1 cut(s)	363
HinP1I	GCGC	1 cut(s)	363
HincII	GTYRAC	2 cut(s)	280, 934
HindII	GTYRAC	2 cut(s)	280, 934
HindIII	AAGCTT	1 cut(s)	535
HinfI	GANTC	2 cut(s)	74, 281
HpaI	GTTAAC	1 cut(s)	934
HpaII	CCGG	7 cut(s)	9, 237, 263, 273, 413, 456, 480
HphI	GGTGA	1 cut(s)	410
Hpy166II	GTNNAC	2 cut(s)	280, 934
Hpy188I	TCNGA	7 cut(s)	115, 249, 302, 504, 517, 526, 593
Hpy188III	TCNNGA	7 cut(s)	165, 194, 196, 204, 463, 647, 1007
Hpy8I	GTNNAC	2 cut(s)	280, 934
Hpy99I	CGWCG	2 cut(s)	253, 632
HpyAV	CCTTC	1 cut(s)	644
HpyCH4III	ACNGT	1 cut(s)	339
HpyCH4IV	ACGT	3 cut(s)	255, 556, 856
HpyCH4V	TGCA	7 cut(s)	185, 476, 614, 778, 854, 918, 1070
HpyF10VI	GCNNNNNNNGC	2 cut(s)	319, 775
HpyF3I	CTNAG	2 cut(s)	711, 896
HpySE526I	ACGT	3 cut(s)	255, 556, 856
Hsp92II	CATG	4 cut(s)	61, 650, 835, 964
HspAI	GCGC	1 cut(s)	363
KspAI	GTTAAC	1 cut(s)	934
Kzo9I	GATC	3 cut(s)	206, 227, 619
LmnI	GCTCC	3 cut(s)	69, 250, 848
Lsp1109I	GCAGC	5 cut(s)	48, 488, 719, 722, 838
LweI	GCATC	2 cut(s)	172, 787
MaeI	CTAG	3 cut(s)	102, 159, 924
MaeII	ACGT	3 cut(s)	255, 556, 856
MalI	GATC	3 cut(s)	208, 229, 621
MboI	GATC	3 cut(s)	206, 227, 619
MboII	GAAGA	4 cut(s)	400, 808, 813, 957
MhlI	GDGCHC	3 cut(s)	247, 636, 1083
MluCI	AATT	8 cut(s)	497, 519, 547, 577, 665, 826, 913, 1031
MlyI	GAGTC	2 cut(s)	68, 275
MmeI	TCCRAC	3 cut(s)	110, 272, 696
MroXI	GAANNNNTTC	1 cut(s)	840
MseI	TTAA	2 cut(s)	912, 933
MslI	CAYNNNNRTG	2 cut(s)	358, 959
MspI	CCGG	7 cut(s)	9, 237, 263, 273, 413, 456, 480
MvnI	CGCG	1 cut(s)	618
MwoI	GCNNNNNNNGC	2 cut(s)	319, 775
NdeI	CATATG	1 cut(s)	889
NdeII	GATC	3 cut(s)	206, 227, 619
NlaIII	CATG	4 cut(s)	61, 650, 835, 964
NlaIV	GGNNCC	1 cut(s)	55
NsbI	TGCGCA	1 cut(s)	364
PaeR7I	CTCGAG	1 cut(s)	194
PagI	TCATGA	1 cut(s)	646
PdmI	GAANNNNTTC	1 cut(s)	840
PinAI	ACCGGT	1 cut(s)	236
Ple19I	CGATCG	3 cut(s)	209, 230, 622
PleI	GAGTC	2 cut(s)	68, 275
PpsI	GAGTC	2 cut(s)	68, 275
Psp124BI	GAGCTC	2 cut(s)	247, 636
Psp1406I	AACGTT	1 cut(s)	556
PspN4I	GGNNCC	1 cut(s)	55
PspPI	GGNCC	1 cut(s)	54
PstI	CTGCAG	1 cut(s)	478
PvuI	CGATCG	3 cut(s)	209, 230, 622
RseI	CAYNNNNRTG	2 cut(s)	358, 959
SacI	GAGCTC	2 cut(s)	247, 636
SaqAI	TTAA	2 cut(s)	912, 933
Sau3AI	GATC	3 cut(s)	206, 227, 619
Sau96I	GGNCC	1 cut(s)	54
SchI	GAGTC	2 cut(s)	68, 275
SduI	GDGCHC	3 cut(s)	247, 636, 1083
SfaNI	GCATC	2 cut(s)	172, 787
SfcI	CTRYAG	2 cut(s)	323, 474
Sfr274I	CTCGAG	1 cut(s)	194
SlaI	CTCGAG	1 cut(s)	194
SmiMI	CAYNNNNRTG	2 cut(s)	358, 959
SmlI	CTYRAG	2 cut(s)	194, 1043
SmoI	CTYRAG	2 cut(s)	194, 1043
SpeI	ACTAGT	1 cut(s)	158
Sse9I	AATT	8 cut(s)	497, 519, 547, 577, 665, 826, 913, 1031
SspI	AATATT	1 cut(s)	510
SspMI	CTAG	3 cut(s)	102, 159, 924
SstI	GAGCTC	2 cut(s)	247, 636
TaaI	ACNGT	1 cut(s)	339
TaiI	ACGT	3 cut(s)	258, 559, 859
TasI	AATT	8 cut(s)	497, 519, 547, 577, 665, 826, 913, 1031
TauI	GCSGC	7 cut(s)	8, 28, 31, 316, 319, 322, 1094
Tru1I	TTAA	2 cut(s)	912, 933
Tru9I	TTAA	2 cut(s)	912, 933
TscAI	CASTG	2 cut(s)	757, 1077
TseI	GCWGC	5 cut(s)	61, 476, 732, 735, 851
TspDTI	ATGAA	8 cut(s)	135, 570, 635, 663, 820, 873, 906, 949
TspGWI	ACGGA	1 cut(s)	595
TspRI	CASTG	2 cut(s)	757, 1077
XapI	RAATTY	4 cut(s)	497, 519, 665, 1031
XcmI	CCANNNNNNNNNTGG	1 cut(s)	749
XhoI	CTCGAG	1 cut(s)	194
XmnI	GAANNNNTTC	1 cut(s)	840
XspI	CTAG	3 cut(s)	102, 159, 924

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.