Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002689.1

Orthogroup ID

OG0001091

Physical Location & Seq

Genomic Coordinates Reverse (-)

1923 .. 3096

Gene Structure 1174 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002689.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 453 bp

atggactgcagtagttctgatgtggttcctgtaattccaccaaacagcaacatgtcatccatgtccgaaattcctgtaagtcctacatcagttgcatccagtggtcatttccctttcactgcctcagaaatatcaggaatgggagtagacacatcggcacttgatacaacatttacatctgatgtggcaagtaatgggttgcagcttggacccgatggtgggggtggcagatcactggatcagatccagtggaatttcagcctatcagatcttacagcggatttgtccaacttaggagatttaggagccttgggaaactatcctggctccccctttctgccttctgattctgaaattctactcgactctcccgagcaagaggatatagaggaattctttgtcgattctgtccccgagccaccttgctctcaatcagacgacgagaaaccctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

A_thal_3526

Protein Analysis

150

Amino Acids

15.6

Weight (kDa)

4.05

Isoelectric Point (pI)

73.19

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001091)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G46420 AT2G46420 AT2G46420 AT3G61700 AT3G61700 AT3G61700 AT3G61700
fragaria_vesca	FvH4_7g16290 FvH4_7g16290 FvH4_7g16290 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180
malus_domestica	MD01G1079500.v1.1 MD01G1216500.v1.1 MD07G1148300.v1.1 MD07G1286500.v1.1 MD12G1148300.v1.1
prunus_persica	Prupe.2G186600_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1
pyrus_communis	pycom01g10780 pycom01g22720 pycom07g14730 pycom07g25960
rosa_chinensis	RchiOBHm_Chr1g0359301 RchiOBHm_Chr1g0380221
rosa_laevigata	RLG00000026317 RLG00000027882
rosa_multiflora	Rmu_co8458617.1_g000001 Rmu_sc0001232.1_g000028 Rmu_sc0002689.1_g000001 Rmu_ssc0000135.1_g000052
rosa_roxburghii	Rroxscaffold_4G00279550 Rroxscaffold_4G00297130
rosa_rugosa	Rorug01G0269300 Rorug01G0269400 Rorug01G0419200
rosa_samantha	Rh1AG283300 Rh1AG444000 Rh1BG249500 Rh1BG399100 Rh1CG267400 Rh1CG412500 Rh1DG278400 Rh1DG429600
rosa_wichuraiana	Rw1G025150 Rw1G038560 Rw1G038630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	147
AciI	CCGC	1 cut(s)	278
AclWI	GGATC	2 cut(s)	238, 246
AcsI	RAATTY	4 cut(s)	69, 253, 354, 392
AfiI	CCNNNNNNNGG	2 cut(s)	218, 219
AflIII	ACRYGT	1 cut(s)	51
AjnI	CCWGG	1 cut(s)	322
AluBI	AGCT	1 cut(s)	205
AluI	AGCT	1 cut(s)	205
AlwI	GGATC	2 cut(s)	238, 246
Ama87I	CYCGRG	2 cut(s)	371, 413
ApeKI	GCWGC	1 cut(s)	202
ApoI	RAATTY	4 cut(s)	69, 253, 354, 392
AspS9I	GGNCC	1 cut(s)	209
AvaI	CYCGRG	2 cut(s)	371, 413
AvaII	GGWCC	1 cut(s)	209
BbvI	GCAGC	1 cut(s)	214
BccI	CCATC	1 cut(s)	209
BciT130I	CCWGG	1 cut(s)	324
BfaI	CTAG	1 cut(s)	451
BfmI	CTRYAG	1 cut(s)	7
BglII	AGATCT	1 cut(s)	268
BisI	GCNGC	1 cut(s)	203
BlsI	GCNGC	1 cut(s)	204
Bme1390I	CCNGG	1 cut(s)	324
Bme18I	GGWCC	1 cut(s)	209
BmeT110I	CYCGRG	2 cut(s)	371, 413
BmgT120I	GGNCC	1 cut(s)	209
BmiI	GGNNCC	4 cut(s)	27, 211, 307, 328
BmrFI	CCNGG	1 cut(s)	324
BmsI	GCATC	1 cut(s)	104
BsaJI	CCNNGG	1 cut(s)	309
Bsc4I	CCNNNNNNNGG	2 cut(s)	218, 219
Bse1I	ACTGG	3 cut(s)	99, 240, 247
BseBI	CCWGG	1 cut(s)	324
BseDI	CCNNGG	1 cut(s)	309
BseGI	GGATG	2 cut(s)	56, 95
BseLI	CCNNNNNNNGG	2 cut(s)	218, 219
BseMII	CTCAG	1 cut(s)	138
BseNI	ACTGG	3 cut(s)	99, 240, 247
BseXI	GCAGC	1 cut(s)	214
BsiHKCI	CYCGRG	2 cut(s)	371, 413
BslFI	GGGAC	1 cut(s)	395
BslI	CCNNNNNNNGG	2 cut(s)	218, 219
BsmFI	GGGAC	1 cut(s)	395
BsoBI	CYCGRG	2 cut(s)	371, 413
Bsp143I	GATC	4 cut(s)	230, 238, 243, 268
BspACI	CCGC	1 cut(s)	278
BspCNI	CTCAG	1 cut(s)	137
BspLI	GGNNCC	4 cut(s)	27, 211, 307, 328
BspMAI	CTGCAG	1 cut(s)	11
BspPI	GGATC	2 cut(s)	238, 246
BsrI	ACTGG	3 cut(s)	99, 240, 247
BssECI	CCNNGG	1 cut(s)	309
BssMI	GATC	4 cut(s)	230, 238, 243, 268
BssT1I	CCWWGG	1 cut(s)	309
Bst2UI	CCWGG	1 cut(s)	324
BstDEI	CTNAG	2 cut(s)	124, 292
BstF5I	GGATG	2 cut(s)	56, 95
BstKTI	GATC	4 cut(s)	233, 241, 246, 271
BstMBI	GATC	4 cut(s)	230, 238, 243, 268
BstNI	CCWGG	1 cut(s)	324
BstNSI	RCATGY	1 cut(s)	55
BstSCI	CCNGG	1 cut(s)	322
BstSFI	CTRYAG	1 cut(s)	7
BstV1I	GCAGC	1 cut(s)	214
BstX2I	RGATCY	2 cut(s)	243, 268
BstYI	RGATCY	2 cut(s)	243, 268
BtsCI	GGATG	2 cut(s)	56, 95
BtsI	GCAGTG	1 cut(s)	117
BtsIMutI	CAGTG	4 cut(s)	106, 117, 233, 254
Cfr13I	GGNCC	1 cut(s)	209
CviAII	CATG	2 cut(s)	52, 61
CviJI	RGCY	5 cut(s)	205, 261, 308, 327, 418
CviKI_1	RGCY	5 cut(s)	205, 261, 308, 327, 418
DdeI	CTNAG	2 cut(s)	124, 292
DpnI	GATC	4 cut(s)	232, 240, 245, 270
DpnII	GATC	4 cut(s)	230, 238, 243, 268
Eco130I	CCWWGG	1 cut(s)	309
Eco47I	GGWCC	1 cut(s)	209
Eco88I	CYCGRG	2 cut(s)	371, 413
EcoRI	GAATTC	1 cut(s)	392
EcoRII	CCWGG	1 cut(s)	322
EcoT14I	CCWWGG	1 cut(s)	309
ErhI	CCWWGG	1 cut(s)	309
FaeI	CATG	2 cut(s)	55, 64
FaiI	YATR	3 cut(s)	53, 62, 386
FaqI	GGGAC	1 cut(s)	395
FatI	CATG	2 cut(s)	51, 60
FblI	GTMKAC	1 cut(s)	147
Fnu4HI	GCNGC	1 cut(s)	203
FokI	GGATG	2 cut(s)	43, 82
Fsp4HI	GCNGC	1 cut(s)	203
FspBI	CTAG	1 cut(s)	451
GluI	GCNGC	1 cut(s)	203
Hin1II	CATG	2 cut(s)	55, 64
HinfI	GANTC	3 cut(s)	347, 365, 404
Hpy166II	GTNNAC	1 cut(s)	148
Hpy188I	TCNGA	9 cut(s)	19, 67, 127, 181, 243, 268, 346, 352, 436
Hpy188III	TCNNGA	2 cut(s)	135, 371
Hpy8I	GTNNAC	1 cut(s)	148
Hpy99I	CGWCG	1 cut(s)	443
HpyAV	CCTTC	1 cut(s)	351
HpyCH4V	TGCA	3 cut(s)	9, 95, 202
HpyF3I	CTNAG	2 cut(s)	124, 292
Hsp92II	CATG	2 cut(s)	55, 64
Kzo9I	GATC	4 cut(s)	230, 238, 243, 268
LmnI	GCTCC	2 cut(s)	305, 332
LpnPI	CCDG	8 cut(s)	42, 87, 112, 120, 221, 260, 309, 336
Lsp1109I	GCAGC	1 cut(s)	214
LweI	GCATC	1 cut(s)	104
MaeI	CTAG	1 cut(s)	451
MalI	GATC	4 cut(s)	232, 240, 245, 270
MboI	GATC	4 cut(s)	230, 238, 243, 268
MflI	RGATCY	2 cut(s)	243, 268
MluCI	AATT	5 cut(s)	33, 69, 253, 354, 392
MlyI	GAGTC	1 cut(s)	359
MmeI	TCCRAC	1 cut(s)	312
MnlI	CCTC	3 cut(s)	133, 373, 382
MspA1I	CMGCKG	1 cut(s)	278
MspR9I	CCNGG	1 cut(s)	324
MvaI	CCWGG	1 cut(s)	324
NdeII	GATC	4 cut(s)	230, 238, 243, 268
NlaIII	CATG	2 cut(s)	55, 64
NlaIV	GGNNCC	4 cut(s)	27, 211, 307, 328
NspI	RCATGY	1 cut(s)	55
PciI	ACATGT	1 cut(s)	51
PcsI	WCGNNNNNNNCGW	1 cut(s)	369
PfeI	GAWTC	2 cut(s)	347, 404
PkrI	GCNGC	1 cut(s)	204
PleI	GAGTC	1 cut(s)	359
PpsI	GAGTC	1 cut(s)	359
PscI	ACATGT	1 cut(s)	51
Psp6I	CCWGG	1 cut(s)	322
PspGI	CCWGG	1 cut(s)	322
PspN4I	GGNNCC	4 cut(s)	27, 211, 307, 328
PspPI	GGNCC	1 cut(s)	209
PstI	CTGCAG	1 cut(s)	11
PsuI	RGATCY	2 cut(s)	243, 268
SatI	GCNGC	1 cut(s)	203
Sau3AI	GATC	4 cut(s)	230, 238, 243, 268
Sau96I	GGNCC	1 cut(s)	209
SchI	GAGTC	1 cut(s)	359
ScrFI	CCNGG	1 cut(s)	324
SetI	ASST	2 cut(s)	207, 424
SfaNI	GCATC	1 cut(s)	104
SfcI	CTRYAG	1 cut(s)	7
SinI	GGWCC	1 cut(s)	209
Sse9I	AATT	5 cut(s)	33, 69, 253, 354, 392
SsiI	CCGC	1 cut(s)	278
SspMI	CTAG	1 cut(s)	451
StyD4I	CCNGG	1 cut(s)	322
StyI	CCWWGG	1 cut(s)	309
TaqI	TCGA	2 cut(s)	363, 402
TasI	AATT	5 cut(s)	33, 69, 253, 354, 392
TfiI	GAWTC	2 cut(s)	347, 404
TscAI	CASTG	4 cut(s)	106, 124, 240, 254
TseI	GCWGC	1 cut(s)	202
TspRI	CASTG	4 cut(s)	106, 124, 240, 254
VpaK11BI	GGWCC	1 cut(s)	209
XapI	RAATTY	4 cut(s)	69, 253, 354, 392
XceI	RCATGY	1 cut(s)	55
XmiI	GTMKAC	1 cut(s)	147
XspI	CTAG	1 cut(s)	451

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.