Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr1

Orthogroup ID

OG0001091

Physical Location & Seq

Genomic Coordinates Forward (+)

66160502 .. 66163831

Gene Structure 3330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw1G038630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 519 bp

ATGAAAATCCTTAGCATTGCAAAGAACAAGAGCAGCAAAGTCACACTTCAAGATATTCAAGTTGTCCAGAATTTGATTGAAAGGTGTCTGCAGTTGTATATGAACAGAGATGAAGTCATCAATACCCTCTTAGATCGTGCTAGGATTGAGCCTGAGTTTACAAAACTGGTATGGCAGAAACTGGAAGAAGAAAATGGAGAATTTTTCAAGGCCTACCACCTAAGGCTAAAGCTCAAAGATCAAATTCATATGTATAACCGGTTGCTTGAGCAGCAATACCATCTGATGAAACAGCAAGAGCGTGCAGAGTTTGAGATAGCTCCTGTGCAGAATGGAATGCATCACATGCCAGTCAACAATTTATCTATGGAATGTGCCATCATGCAGCAGCATCTTATTCCATCTACAGGTTATTTCGGGATCAATTCCATGGCCACCATATCTGGTTGTCATGGAGTTAATGGAATACCTGCTCCAGGAAACTTCCACCGTATGCAACATAAGTGTGCGAAAGAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

A_thal_3526

Protein Analysis

172

Amino Acids

20.06

Weight (kDa)

8.34

Isoelectric Point (pI)

50.22

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
A_thal_3526	PF09713	22 - 73	5.1e-26	Plant protein 1589 of unknown function (A_thal_3526)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001091)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G46420 AT2G46420 AT2G46420 AT3G61700 AT3G61700 AT3G61700 AT3G61700
fragaria_vesca	FvH4_7g16290 FvH4_7g16290 FvH4_7g16290 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180
malus_domestica	MD01G1079500.v1.1 MD01G1216500.v1.1 MD07G1148300.v1.1 MD07G1286500.v1.1 MD12G1148300.v1.1
prunus_persica	Prupe.2G186600_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1
pyrus_communis	pycom01g10780 pycom01g22720 pycom07g14730 pycom07g25960
rosa_chinensis	RchiOBHm_Chr1g0359301 RchiOBHm_Chr1g0380221
rosa_laevigata	RLG00000026317 RLG00000027882
rosa_multiflora	Rmu_co8458617.1_g000001 Rmu_sc0001232.1_g000028 Rmu_sc0002689.1_g000001 Rmu_ssc0000135.1_g000052
rosa_roxburghii	Rroxscaffold_4G00279550 Rroxscaffold_4G00297130
rosa_rugosa	Rorug01G0269300 Rorug01G0269400 Rorug01G0419200
rosa_samantha	Rh1AG283300 Rh1AG444000 Rh1BG249500 Rh1BG399100 Rh1CG267400 Rh1CG412500 Rh1DG278400 Rh1DG429600
rosa_wichuraiana	Rw1G025150 Rw1G038560 Rw1G038630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	478
AclWI	GGATC	1 cut(s)	428
AcoI	YGGCCR	1 cut(s)	432
AcsI	RAATTY	3 cut(s)	70, 200, 243
AfiI	CCNNNNNNNGG	2 cut(s)	407, 476
AgeI	ACCGGT	1 cut(s)	258
AgsI	TTSAA	4 cut(s)	50, 59, 80, 208
AjnI	CCWGG	1 cut(s)	475
AluBI	AGCT	2 cut(s)	232, 320
AluI	AGCT	2 cut(s)	232, 320
AlwI	GGATC	1 cut(s)	428
AlwNI	CAGNNNCTG	1 cut(s)	181
AoxI	GGCC	2 cut(s)	210, 432
ApeKI	GCWGC	4 cut(s)	33, 271, 385, 388
ApoI	RAATTY	3 cut(s)	70, 200, 243
AsiGI	ACCGGT	1 cut(s)	258
AxyI	CCTNAGG	1 cut(s)	221
BalI	TGGCCA	1 cut(s)	434
BbvI	GCAGC	4 cut(s)	45, 283, 397, 400
BccI	CCATC	3 cut(s)	288, 386, 409
BciT130I	CCWGG	1 cut(s)	477
BfaI	CTAG	1 cut(s)	141
BfmI	CTRYAG	2 cut(s)	89, 405
BfuAI	ACCTGC	1 cut(s)	478
BisI	GCNGC	4 cut(s)	34, 272, 386, 389
BlsI	GCNGC	4 cut(s)	35, 273, 387, 390
Bme1390I	CCNGG	1 cut(s)	477
BmrFI	CCNGG	1 cut(s)	477
BmsI	GCATC	2 cut(s)	349, 400
BpmI	CTGGAG	1 cut(s)	459
Bpu10I	CCTNAGC	1 cut(s)	11
BpuEI	CTTGAG	1 cut(s)	287
BsaJI	CCNNGG	1 cut(s)	429
BsaWI	WCCGGW	1 cut(s)	258
Bsc4I	CCNNNNNNNGG	2 cut(s)	407, 476
Bse118I	RCCGGY	1 cut(s)	258
Bse1I	ACTGG	3 cut(s)	171, 186, 350
Bse21I	CCTNAGG	1 cut(s)	221
Bse3DI	GCAATG	1 cut(s)	15
BseBI	CCWGG	1 cut(s)	477
BseDI	CCNNGG	1 cut(s)	429
BseLI	CCNNNNNNNGG	2 cut(s)	407, 476
BseMI	GCAATG	1 cut(s)	15
BseMII	CTCAG	1 cut(s)	144
BseNI	ACTGG	3 cut(s)	171, 186, 350
BseXI	GCAGC	4 cut(s)	45, 283, 397, 400
BsgI	GTGCAG	2 cut(s)	324, 347
BshFI	GGCC	2 cut(s)	212, 434
BshTI	ACCGGT	1 cut(s)	258
BsiSI	CCGG	1 cut(s)	259
BslI	CCNNNNNNNGG	2 cut(s)	407, 476
BsmI	GAATGC	1 cut(s)	342
BsnI	GGCC	2 cut(s)	212, 434
Bsp143I	GATC	3 cut(s)	133, 238, 420
Bsp19I	CCATGG	1 cut(s)	429
BspANI	GGCC	2 cut(s)	212, 434
BspCNI	CTCAG	1 cut(s)	145
BspMAI	CTGCAG	1 cut(s)	93
BspMI	ACCTGC	1 cut(s)	478
BspPI	GGATC	1 cut(s)	428
BsrDI	GCAATG	1 cut(s)	15
BsrFI	RCCGGY	1 cut(s)	258
BsrI	ACTGG	3 cut(s)	171, 186, 350
BssAI	RCCGGY	1 cut(s)	258
BssECI	CCNNGG	1 cut(s)	429
BssMI	GATC	3 cut(s)	133, 238, 420
BssT1I	CCWWGG	1 cut(s)	429
Bst2UI	CCWGG	1 cut(s)	477
Bst4CI	ACNGT	1 cut(s)	491
BstAPI	GCANNNNNTGC	1 cut(s)	346
BstC8I	GCNNGC	1 cut(s)	303
BstDEI	CTNAG	4 cut(s)	11, 130, 153, 221
BstDSI	CCRYGG	1 cut(s)	429
BstENI	CCTNNNNNAGG	1 cut(s)	474
BstKTI	GATC	3 cut(s)	136, 241, 423
BstMBI	GATC	3 cut(s)	133, 238, 420
BstMWI	GCNNNNNNNGC	2 cut(s)	271, 346
BstNI	CCWGG	1 cut(s)	477
BstNSI	RCATGY	1 cut(s)	349
BstSCI	CCNGG	1 cut(s)	475
BstSFI	CTRYAG	2 cut(s)	89, 405
BstV1I	GCAGC	4 cut(s)	45, 283, 397, 400
Bsu36I	CCTNAGG	1 cut(s)	221
BsuRI	GGCC	2 cut(s)	212, 434
BtgI	CCRYGG	1 cut(s)	429
BveI	ACCTGC	1 cut(s)	478
Cac8I	GCNNGC	1 cut(s)	303
CaiI	CAGNNNCTG	1 cut(s)	181
Cfr10I	RCCGGY	1 cut(s)	258
CspAI	ACCGGT	1 cut(s)	258
CviAII	CATG	4 cut(s)	346, 382, 430, 452
CviJI	RGCY	6 cut(s)	151, 212, 226, 232, 320, 434
CviKI_1	RGCY	6 cut(s)	151, 212, 226, 232, 320, 434
DdeI	CTNAG	4 cut(s)	11, 130, 153, 221
DpnI	GATC	3 cut(s)	135, 240, 422
DpnII	GATC	3 cut(s)	133, 238, 420
EaeI	YGGCCR	1 cut(s)	432
Eco130I	CCWWGG	1 cut(s)	429
Eco147I	AGGCCT	1 cut(s)	212
Eco81I	CCTNAGG	1 cut(s)	221
EcoNI	CCTNNNNNAGG	1 cut(s)	474
EcoRII	CCWGG	1 cut(s)	475
EcoT14I	CCWWGG	1 cut(s)	429
EcoT22I	ATGCAT	1 cut(s)	342
ErhI	CCWWGG	1 cut(s)	429
FaeI	CATG	4 cut(s)	349, 385, 433, 455
FalI	AAGNNNNNCTT	2 cut(s)	30, 62
FatI	CATG	4 cut(s)	345, 381, 429, 451
FauNDI	CATATG	1 cut(s)	249
Fnu4HI	GCNGC	4 cut(s)	34, 272, 386, 389
Fsp4HI	GCNGC	4 cut(s)	34, 272, 386, 389
FspBI	CTAG	1 cut(s)	141
GluI	GCNGC	4 cut(s)	34, 272, 386, 389
GsuI	CTGGAG	1 cut(s)	459
HaeIII	GGCC	2 cut(s)	212, 434
HapII	CCGG	1 cut(s)	259
Hin1II	CATG	4 cut(s)	349, 385, 433, 455
HincII	GTYRAC	1 cut(s)	355
HindII	GTYRAC	1 cut(s)	355
HpaII	CCGG	1 cut(s)	259
Hpy166II	GTNNAC	2 cut(s)	159, 355
Hpy188I	TCNGA	1 cut(s)	285
Hpy188III	TCNNGA	3 cut(s)	50, 67, 418
Hpy8I	GTNNAC	2 cut(s)	159, 355
HpyCH4III	ACNGT	1 cut(s)	491
HpyCH4V	TGCA	7 cut(s)	20, 91, 305, 328, 340, 385, 496
HpyF10VI	GCNNNNNNNGC	2 cut(s)	271, 346
HpyF3I	CTNAG	4 cut(s)	11, 130, 153, 221
Hsp92II	CATG	4 cut(s)	349, 385, 433, 455
Kzo9I	GATC	3 cut(s)	133, 238, 420
LmnI	GCTCC	2 cut(s)	325, 478
Lsp1109I	GCAGC	4 cut(s)	45, 283, 397, 400
LweI	GCATC	2 cut(s)	349, 400
MaeI	CTAG	1 cut(s)	141
MaeIII	GTNAC	1 cut(s)	40
MalI	GATC	3 cut(s)	135, 240, 422
MboI	GATC	3 cut(s)	133, 238, 420
MboII	GAAGA	2 cut(s)	197, 200
MlsI	TGGCCA	1 cut(s)	434
MluCI	AATT	5 cut(s)	70, 200, 243, 358, 424
MluNI	TGGCCA	1 cut(s)	434
MnlI	CCTC	1 cut(s)	137
Mox20I	TGGCCA	1 cut(s)	434
Mph1103I	ATGCAT	1 cut(s)	342
MscI	TGGCCA	1 cut(s)	434
MseI	TTAA	1 cut(s)	459
MslI	CAYNNNNRTG	1 cut(s)	504
Msp20I	TGGCCA	1 cut(s)	434
MspI	CCGG	1 cut(s)	259
MspR9I	CCNGG	1 cut(s)	477
Mva1269I	GAATGC	1 cut(s)	342
MvaI	CCWGG	1 cut(s)	477
MwoI	GCNNNNNNNGC	2 cut(s)	271, 346
NcoI	CCATGG	1 cut(s)	429
NdeI	CATATG	1 cut(s)	249
NdeII	GATC	3 cut(s)	133, 238, 420
NlaIII	CATG	4 cut(s)	349, 385, 433, 455
NmuCI	GTSAC	1 cut(s)	40
NsiI	ATGCAT	1 cut(s)	342
NspI	RCATGY	1 cut(s)	349
PceI	AGGCCT	1 cut(s)	212
PctI	GAATGC	1 cut(s)	342
PfoI	TCCNGGA	1 cut(s)	475
PinAI	ACCGGT	1 cut(s)	258
PkrI	GCNGC	4 cut(s)	35, 273, 387, 390
Psp6I	CCWGG	1 cut(s)	475
PspGI	CCWGG	1 cut(s)	475
PstI	CTGCAG	1 cut(s)	93
PstNI	CAGNNNCTG	1 cut(s)	181
RseI	CAYNNNNRTG	1 cut(s)	504
SaqAI	TTAA	1 cut(s)	459
SatI	GCNGC	4 cut(s)	34, 272, 386, 389
Sau3AI	GATC	3 cut(s)	133, 238, 420
ScrFI	CCNGG	1 cut(s)	477
SetI	ASST	6 cut(s)	86, 222, 234, 322, 412, 472
SfaNI	GCATC	2 cut(s)	349, 400
SfcI	CTRYAG	2 cut(s)	89, 405
SmiMI	CAYNNNNRTG	1 cut(s)	504
SmlI	CTYRAG	1 cut(s)	266
SmoI	CTYRAG	1 cut(s)	266
Sse9I	AATT	5 cut(s)	70, 200, 243, 358, 424
SseBI	AGGCCT	1 cut(s)	212
SspMI	CTAG	1 cut(s)	141
StuI	AGGCCT	1 cut(s)	212
StyD4I	CCNGG	1 cut(s)	475
StyI	CCWWGG	1 cut(s)	429
TaaI	ACNGT	1 cut(s)	491
TasI	AATT	5 cut(s)	70, 200, 243, 358, 424
Tru1I	TTAA	1 cut(s)	459
Tru9I	TTAA	1 cut(s)	459
TseFI	GTSAC	1 cut(s)	40
TseI	GCWGC	4 cut(s)	33, 271, 385, 388
Tsp45I	GTSAC	1 cut(s)	40
TspDTI	ATGAA	5 cut(s)	17, 116, 126, 236, 302
XagI	CCTNNNNNAGG	1 cut(s)	474
XapI	RAATTY	3 cut(s)	70, 200, 243
XceI	RCATGY	1 cut(s)	349
XspI	CTAG	1 cut(s)	141
Zsp2I	ATGCAT	1 cut(s)	342

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.