Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0001091

Physical Location & Seq

Genomic Coordinates Reverse (-)

17090298 .. 17095337

Gene Structure 5040 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00297130.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 606 bp

ATGGGATACCCTGTCCTTCAGCAACCTCCAATGCCAGCAGCAGGTCAACCCCATCTTGATTCCATGGGAATATCTAACTGTCATGTAGTTAATGGAGTTCCCGCACCAAGCAATTTCCATCCAATTCGGATGAATTCTGGGAATGATATGGTGATGGACTGCAGTAGTTCTGATGTGGTTCCTGTAATTCCACCAAACAGCAACATGTCATCCATGTCCGAGATTCCTGTAAGTCCTACATCAGTGGCATCCAGTGGTCATTTCCCATTCACTGCATCAGAAATATCAGGAATGGGAGTAGACACATCGGCACTTGATACAACATTTACGTCTGATGTGGCAAGTAATGGGTTGCAGCTTGGACCCGATGGTGGGGGTGGCAGATCACTGGATCAGATCCAGTGGAATTTCAGCCTATCAGATCTTACAGCAGATTTGTCCAACTTAGGAGATTTAGGAGCCTTGGGAAACTATCCTGGCTCCCCCTTTCTGCCTTCTGATTCTGAAATTCTACTCGACTCTCCTGAGCAAGAGGATATAGAGGAATTCTTTGTCGATTCTGTCCCCGAGCCACCTTGCTCTCAATCAGACGAGGAGAAACCCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

A_thal_3526

Protein Analysis

201

Amino Acids

21.01

Weight (kDa)

4.05

Isoelectric Point (pI)

71.94

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001091)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G46420 AT2G46420 AT2G46420 AT3G61700 AT3G61700 AT3G61700 AT3G61700
fragaria_vesca	FvH4_7g16290 FvH4_7g16290 FvH4_7g16290 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180 FvH4_7g31180
malus_domestica	MD01G1079500.v1.1 MD01G1216500.v1.1 MD07G1148300.v1.1 MD07G1286500.v1.1 MD12G1148300.v1.1
prunus_persica	Prupe.2G186600_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1 Prupe.2G308500_v2.0.a1
pyrus_communis	pycom01g10780 pycom01g22720 pycom07g14730 pycom07g25960
rosa_chinensis	RchiOBHm_Chr1g0359301 RchiOBHm_Chr1g0380221
rosa_laevigata	RLG00000026317 RLG00000027882
rosa_multiflora	Rmu_co8458617.1_g000001 Rmu_sc0001232.1_g000028 Rmu_sc0002689.1_g000001 Rmu_ssc0000135.1_g000052
rosa_roxburghii	Rroxscaffold_4G00279550 Rroxscaffold_4G00297130
rosa_rugosa	Rorug01G0269300 Rorug01G0269400 Rorug01G0419200
rosa_samantha	Rh1AG283300 Rh1AG444000 Rh1BG249500 Rh1BG399100 Rh1CG267400 Rh1CG412500 Rh1DG278400 Rh1DG429600
rosa_wichuraiana	Rw1G025150 Rw1G038560 Rw1G038630

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	32
AccI	GTMKAC	1 cut(s)	300
AciI	CCGC	1 cut(s)	102
AclWI	GGATC	2 cut(s)	391, 399
AcsI	RAATTY	4 cut(s)	133, 406, 507, 545
AfiI	CCNNNNNNNGG	3 cut(s)	41, 371, 372
AflIII	ACRYGT	1 cut(s)	204
AjnI	CCWGG	1 cut(s)	475
AluBI	AGCT	1 cut(s)	358
AluI	AGCT	1 cut(s)	358
AlwI	GGATC	2 cut(s)	391, 399
Ama87I	CYCGRG	1 cut(s)	566
ApeKI	GCWGC	2 cut(s)	38, 355
ApoI	RAATTY	4 cut(s)	133, 406, 507, 545
AspS9I	GGNCC	1 cut(s)	362
AsuHPI	GGTGA	1 cut(s)	163
AvaI	CYCGRG	1 cut(s)	566
AvaII	GGWCC	1 cut(s)	362
BbvI	GCAGC	2 cut(s)	50, 367
BccI	CCATC	4 cut(s)	60, 126, 148, 362
BciT130I	CCWGG	1 cut(s)	477
BfaI	CTAG	1 cut(s)	604
BfmI	CTRYAG	1 cut(s)	160
BfuAI	ACCTGC	1 cut(s)	32
BglII	AGATCT	1 cut(s)	421
BisI	GCNGC	2 cut(s)	39, 356
BlsI	GCNGC	2 cut(s)	40, 357
Bme1390I	CCNGG	1 cut(s)	477
Bme18I	GGWCC	1 cut(s)	362
BmeT110I	CYCGRG	1 cut(s)	566
BmgT120I	GGNCC	1 cut(s)	362
BmiI	GGNNCC	4 cut(s)	180, 364, 460, 481
BmrFI	CCNGG	1 cut(s)	477
BmsI	GCATC	2 cut(s)	257, 284
Bpu10I	CCTNAGC	1 cut(s)	525
BsaJI	CCNNGG	2 cut(s)	63, 462
Bsc4I	CCNNNNNNNGG	3 cut(s)	41, 371, 372
Bse1I	ACTGG	3 cut(s)	252, 393, 400
BseBI	CCWGG	1 cut(s)	477
BseDI	CCNNGG	2 cut(s)	63, 462
BseGI	GGATG	4 cut(s)	118, 135, 209, 248
BseLI	CCNNNNNNNGG	3 cut(s)	41, 371, 372
BseMII	CTCAG	1 cut(s)	516
BseNI	ACTGG	3 cut(s)	252, 393, 400
BseXI	GCAGC	2 cut(s)	50, 367
BsiHKCI	CYCGRG	1 cut(s)	566
BslFI	GGGAC	1 cut(s)	548
BslI	CCNNNNNNNGG	3 cut(s)	41, 371, 372
BsmFI	GGGAC	1 cut(s)	548
BsoBI	CYCGRG	1 cut(s)	566
Bsp143I	GATC	4 cut(s)	383, 391, 396, 421
Bsp19I	CCATGG	1 cut(s)	63
BspACI	CCGC	1 cut(s)	102
BspCNI	CTCAG	1 cut(s)	517
BspLI	GGNNCC	4 cut(s)	180, 364, 460, 481
BspMAI	CTGCAG	1 cut(s)	164
BspMI	ACCTGC	1 cut(s)	32
BspPI	GGATC	2 cut(s)	391, 399
BsrI	ACTGG	3 cut(s)	252, 393, 400
BssECI	CCNNGG	2 cut(s)	63, 462
BssMI	GATC	4 cut(s)	383, 391, 396, 421
BssT1I	CCWWGG	2 cut(s)	63, 462
Bst2UI	CCWGG	1 cut(s)	477
Bst4CI	ACNGT	1 cut(s)	80
BstC8I	GCNNGC	1 cut(s)	36
BstDEI	CTNAG	2 cut(s)	445, 525
BstDSI	CCRYGG	1 cut(s)	63
BstF5I	GGATG	4 cut(s)	118, 135, 209, 248
BstKTI	GATC	4 cut(s)	386, 394, 399, 424
BstMBI	GATC	4 cut(s)	383, 391, 396, 421
BstNI	CCWGG	1 cut(s)	477
BstNSI	RCATGY	1 cut(s)	208
BstSCI	CCNGG	1 cut(s)	475
BstSFI	CTRYAG	1 cut(s)	160
BstV1I	GCAGC	2 cut(s)	50, 367
BstX2I	RGATCY	2 cut(s)	396, 421
BstYI	RGATCY	2 cut(s)	396, 421
BtgI	CCRYGG	1 cut(s)	63
BtsCI	GGATG	4 cut(s)	118, 135, 209, 248
BtsI	GCAGTG	1 cut(s)	270
BtsIMutI	CAGTG	5 cut(s)	249, 259, 270, 386, 407
BveI	ACCTGC	1 cut(s)	32
Cac8I	GCNNGC	1 cut(s)	36
Cfr13I	GGNCC	1 cut(s)	362
CviAII	CATG	4 cut(s)	64, 83, 205, 214
CviJI	RGCY	5 cut(s)	358, 414, 461, 480, 571
CviKI_1	RGCY	5 cut(s)	358, 414, 461, 480, 571
DdeI	CTNAG	2 cut(s)	445, 525
DpnI	GATC	4 cut(s)	385, 393, 398, 423
DpnII	GATC	4 cut(s)	383, 391, 396, 421
Eco130I	CCWWGG	2 cut(s)	63, 462
Eco47I	GGWCC	1 cut(s)	362
Eco88I	CYCGRG	1 cut(s)	566
EcoRI	GAATTC	2 cut(s)	133, 545
EcoRII	CCWGG	1 cut(s)	475
EcoT14I	CCWWGG	2 cut(s)	63, 462
ErhI	CCWWGG	2 cut(s)	63, 462
FaeI	CATG	4 cut(s)	67, 86, 208, 217
FaiI	YATR	6 cut(s)	65, 84, 149, 206, 215, 539
FaqI	GGGAC	1 cut(s)	548
FatI	CATG	4 cut(s)	63, 82, 204, 213
FauI	CCCGC	1 cut(s)	109
FblI	GTMKAC	1 cut(s)	300
Fnu4HI	GCNGC	2 cut(s)	39, 356
FokI	GGATG	4 cut(s)	105, 142, 196, 235
Fsp4HI	GCNGC	2 cut(s)	39, 356
FspBI	CTAG	1 cut(s)	604
GluI	GCNGC	2 cut(s)	39, 356
Hin1II	CATG	4 cut(s)	67, 86, 208, 217
HincII	GTYRAC	1 cut(s)	47
HindII	GTYRAC	1 cut(s)	47
HinfI	GANTC	5 cut(s)	59, 223, 500, 518, 557
HphI	GGTGA	1 cut(s)	163
Hpy166II	GTNNAC	2 cut(s)	47, 301
Hpy188III	TCNNGA	3 cut(s)	56, 288, 524
Hpy8I	GTNNAC	2 cut(s)	47, 301
HpyAV	CCTTC	2 cut(s)	26, 504
HpyCH4III	ACNGT	1 cut(s)	80
HpyCH4IV	ACGT	1 cut(s)	329
HpyCH4V	TGCA	3 cut(s)	162, 275, 355
HpyF3I	CTNAG	2 cut(s)	445, 525
HpySE526I	ACGT	1 cut(s)	329
Hsp92II	CATG	4 cut(s)	67, 86, 208, 217
Kzo9I	GATC	4 cut(s)	383, 391, 396, 421
LmnI	GCTCC	2 cut(s)	458, 485
Lsp1109I	GCAGC	2 cut(s)	50, 367
LweI	GCATC	2 cut(s)	257, 284
MaeI	CTAG	1 cut(s)	604
MaeII	ACGT	1 cut(s)	329
MalI	GATC	4 cut(s)	385, 393, 398, 423
MboI	GATC	4 cut(s)	383, 391, 396, 421
MflI	RGATCY	2 cut(s)	396, 421
MluCI	AATT	7 cut(s)	112, 123, 133, 186, 406, 507, 545
MlyI	GAGTC	1 cut(s)	512
MmeI	TCCRAC	1 cut(s)	465
MnlI	CCTC	4 cut(s)	36, 526, 535, 586
MseI	TTAA	1 cut(s)	90
MspR9I	CCNGG	1 cut(s)	477
MvaI	CCWGG	1 cut(s)	477
NcoI	CCATGG	1 cut(s)	63
NdeII	GATC	4 cut(s)	383, 391, 396, 421
NlaIII	CATG	4 cut(s)	67, 86, 208, 217
NlaIV	GGNNCC	4 cut(s)	180, 364, 460, 481
NspI	RCATGY	1 cut(s)	208
PciI	ACATGT	1 cut(s)	204
PfeI	GAWTC	4 cut(s)	59, 223, 500, 557
PkrI	GCNGC	2 cut(s)	40, 357
PleI	GAGTC	1 cut(s)	512
PpsI	GAGTC	1 cut(s)	512
PscI	ACATGT	1 cut(s)	204
Psp6I	CCWGG	1 cut(s)	475
PspGI	CCWGG	1 cut(s)	475
PspN4I	GGNNCC	4 cut(s)	180, 364, 460, 481
PspPI	GGNCC	1 cut(s)	362
PstI	CTGCAG	1 cut(s)	164
PsuI	RGATCY	2 cut(s)	396, 421
SaqAI	TTAA	1 cut(s)	90
SatI	GCNGC	2 cut(s)	39, 356
Sau3AI	GATC	4 cut(s)	383, 391, 396, 421
Sau96I	GGNCC	1 cut(s)	362
SchI	GAGTC	1 cut(s)	512
ScrFI	CCNGG	1 cut(s)	477
SetI	ASST	5 cut(s)	28, 46, 332, 360, 577
SfaNI	GCATC	2 cut(s)	257, 284
SfcI	CTRYAG	1 cut(s)	160
SinI	GGWCC	1 cut(s)	362
Sse9I	AATT	7 cut(s)	112, 123, 133, 186, 406, 507, 545
SsiI	CCGC	1 cut(s)	102
SspMI	CTAG	1 cut(s)	604
StyD4I	CCNGG	1 cut(s)	475
StyI	CCWWGG	2 cut(s)	63, 462
TaaI	ACNGT	1 cut(s)	80
TaiI	ACGT	1 cut(s)	332
TaqI	TCGA	2 cut(s)	516, 555
TasI	AATT	7 cut(s)	112, 123, 133, 186, 406, 507, 545
TfiI	GAWTC	4 cut(s)	59, 223, 500, 557
Tru1I	TTAA	1 cut(s)	90
Tru9I	TTAA	1 cut(s)	90
TscAI	CASTG	5 cut(s)	249, 259, 277, 393, 407
TseI	GCWGC	2 cut(s)	38, 355
TspDTI	ATGAA	1 cut(s)	146
TspRI	CASTG	5 cut(s)	249, 259, 277, 393, 407
VpaK11BI	GGWCC	1 cut(s)	362
XapI	RAATTY	4 cut(s)	133, 406, 507, 545
XceI	RCATGY	1 cut(s)	208
XmiI	GTMKAC	1 cut(s)	300
XspI	CTAG	1 cut(s)	604

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.