Rmu_sc0004110.1_g000008
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004110.1
Physical Location & Seq
Forward (+)
31106 .. 31879
774 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004110.1_g000008.1.cds

Sequence Viewer

Length: 774 bp
atggagcaaggaagaggatgcgaaactcagtgtttggtgagggtgattggcagtccgtggcttctgctttgggaggaagaactggtacgcaatgctctaatagatggaaaaaagcaattcatccaaccaggacaagaaaaggtacgtaagtggactttagaggaagacacatgcctgaccgtggctcatattcttttcggggggactaaaaattggaataaaatagctcagttggtgtggaggcgaactcaggtacaatgtcgagataggtttgtcaactctttagaaccttctttgaagtttggtgaatggactgaagaagaagactcgatcctgagagcagcaattggagagcatggacattgctggtcaaaagtttctgcctgtgtacctcagcggactgataatatgtgctggaggagatggaaggtgttgtttccagaggaagtgctggtgctcagagaagagaggagaatacgtaaagctgctcttatctgcaattttgttgactgcgagaaagaacgtccagctcttggccctaatgattttcttgtaccagaggataattcaacaaaaactttaacttttcctaggaagactgggaatataaaaagaggatcacaatctggaaagacaaacaatatctcttcgaattgtcaagttatgaagaagattagatccaagaggcgtaaaaactatgataaaatttgttctaatgaggctgacatatgtaatggggatgatgcctcagattgggatgatactattgcttga

Protein Analysis

257

Amino Acids

29.71

Weight (kDa)

8.57

Isoelectric Point (pI)

55.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 533
AciI CCGC 1 cut(s) 397
AclWI GGATC 3 cut(s) 325, 625, 672
AcsI RAATTY 1 cut(s) 705
AcuI CTGAAG 1 cut(s) 336
AfaI GTAC 5 cut(s) 87, 144, 255, 390, 555
AfiI CCNNNNNNNGG 3 cut(s) 181, 533, 753
AgsI TTSAA 2 cut(s) 298, 570
AjnI CCWGG 1 cut(s) 127
AluBI AGCT 3 cut(s) 227, 485, 530
AluI AGCT 3 cut(s) 227, 485, 530
Alw21I GWGCWC 1 cut(s) 459
AlwI GGATC 3 cut(s) 325, 625, 672
AoxI GGCC 1 cut(s) 535
ApeKI GCWGC 2 cut(s) 341, 485
ApoI RAATTY 1 cut(s) 705
AspA2I CCTAGG 1 cut(s) 590
AspS9I GGNCC 1 cut(s) 536
AsuHPI GGTGA 3 cut(s) 49, 55, 317
AsuII TTCGAA 1 cut(s) 650
AvrII CCTAGG 1 cut(s) 590
BaeI ACNNNNGTAYC 2 cut(s) 134, 167
BarI GAAGNNNNNNTAC 2 cut(s) 69, 101
BbsI GAAGAC 3 cut(s) 171, 330, 602
Bbv12I GWGCWC 1 cut(s) 459
BbvCI CCTCAGC 1 cut(s) 393
BbvI GCAGC 2 cut(s) 353, 472
BccI CCATC 2 cut(s) 98, 417
BciT130I CCWGG 1 cut(s) 129
BfaI CTAG 1 cut(s) 591
BisI GCNGC 2 cut(s) 342, 486
BlnI CCTAGG 1 cut(s) 590
BlsI GCNGC 2 cut(s) 343, 487
Bme1390I CCNGG 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 536
BmrFI CCNGG 1 cut(s) 129
BmrI ACTGGG 1 cut(s) 609
BmsI GCATC 2 cut(s) 8, 733
BmuI ACTGGG 1 cut(s) 609
BpiI GAAGAC 3 cut(s) 171, 330, 602
BplI GAGNNNNNCTC 2 cut(s) 232, 264
BpmI CTGGAG 1 cut(s) 436
Bpu10I CCTNAGC 1 cut(s) 393
Bpu14I TTCGAA 1 cut(s) 650
BsaAI YACGTR 2 cut(s) 146, 479
BsaBI GATNNNNATC 1 cut(s) 622
BsaJI CCNNGG 3 cut(s) 56, 180, 590
BsaXI ACNNNNNCTCC 2 cut(s) 463, 493
Bsc4I CCNNNNNNNGG 3 cut(s) 181, 533, 753
Bse1I ACTGG 2 cut(s) 87, 604
Bse3DI GCAATG 2 cut(s) 97, 361
Bse8I GATNNNNATC 1 cut(s) 622
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 3 cut(s) 56, 180, 590
BseGI GGATG 4 cut(s) 23, 120, 745, 763
BseJI GATNNNNATC 1 cut(s) 622
BseLI CCNNNNNNNGG 3 cut(s) 181, 533, 753
BseMI GCAATG 2 cut(s) 97, 361
BseMII CTCAG 7 cut(s) 41, 242, 263, 326, 407, 472, 762
BseNI ACTGG 2 cut(s) 87, 604
BseRI GAGGAG 2 cut(s) 433, 484
BseXI GCAGC 2 cut(s) 353, 472
BshFI GGCC 1 cut(s) 537
BsiHKAI GWGCWC 1 cut(s) 459
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 3 cut(s) 181, 533, 753
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 1 cut(s) 537
Bsp119I TTCGAA 1 cut(s) 650
Bsp1286I GDGCHC 1 cut(s) 459
Bsp143I GATC 3 cut(s) 330, 617, 677
BspACI CCGC 1 cut(s) 397
BspANI GGCC 1 cut(s) 537
BspCNI CTCAG 7 cut(s) 40, 241, 262, 327, 406, 471, 761
BspPI GGATC 3 cut(s) 325, 625, 672
BspT104I TTCGAA 1 cut(s) 650
BsrDI GCAATG 2 cut(s) 97, 361
BsrI ACTGG 2 cut(s) 87, 604
BssECI CCNNGG 3 cut(s) 56, 180, 590
BssMI GATC 3 cut(s) 330, 617, 677
BssT1I CCWWGG 1 cut(s) 590
Bst2UI CCWGG 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 181
Bst6I CTCTTC 3 cut(s) 7, 459, 652
BstBAI YACGTR 2 cut(s) 146, 479
BstBI TTCGAA 1 cut(s) 650
BstDEI CTNAG 7 cut(s) 27, 228, 249, 335, 393, 458, 748
BstDSI CCRYGG 2 cut(s) 56, 180
BstF5I GGATG 4 cut(s) 23, 120, 745, 763
BstKTI GATC 3 cut(s) 333, 620, 680
BstMBI GATC 3 cut(s) 330, 617, 677
BstNI CCWGG 1 cut(s) 129
BstNSI RCATGY 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 127
BstSNI TACGTA 2 cut(s) 146, 479
BstV1I GCAGC 2 cut(s) 353, 472
BstV2I GAAGAC 3 cut(s) 171, 330, 602
BstX2I RGATCY 1 cut(s) 677
BstYI RGATCY 1 cut(s) 677
BsuRI GGCC 1 cut(s) 537
BtgI CCRYGG 2 cut(s) 56, 180
BtsCI GGATG 4 cut(s) 23, 120, 745, 763
BtsIMutI CAGTG 1 cut(s) 35
Cfr13I GGNCC 1 cut(s) 536
Csp6I GTAC 5 cut(s) 86, 143, 254, 389, 554
CviAII CATG 2 cut(s) 171, 356
CviJI RGCY 7 cut(s) 61, 185, 227, 485, 530, 537, 722
CviKI_1 RGCY 7 cut(s) 61, 185, 227, 485, 530, 537, 722
CviQI GTAC 5 cut(s) 86, 143, 254, 389, 554
DdeI CTNAG 7 cut(s) 27, 228, 249, 335, 393, 458, 748
DpnI GATC 3 cut(s) 332, 619, 679
DpnII GATC 3 cut(s) 330, 617, 677
Eam1104I CTCTTC 3 cut(s) 7, 459, 652
EarI CTCTTC 3 cut(s) 7, 459, 652
Eco105I TACGTA 2 cut(s) 146, 479
Eco130I CCWWGG 1 cut(s) 590
Eco57I CTGAAG 1 cut(s) 336
EcoRII CCWGG 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 590
ErhI CCWWGG 1 cut(s) 590
FaeI CATG 2 cut(s) 174, 359
FaiI YATR 9 cut(s) 172, 189, 357, 410, 608, 665, 699, 728, 730
FalI AAGNNNNNCTT 2 cut(s) 474, 506
FaqI GGGAC 1 cut(s) 217
FatI CATG 2 cut(s) 170, 355
FauNDI CATATG 1 cut(s) 728
Fnu4HI GCNGC 2 cut(s) 342, 486
FokI GGATG 4 cut(s) 30, 107, 752, 770
Fsp4HI GCNGC 2 cut(s) 342, 486
FspBI CTAG 1 cut(s) 591
GluI GCNGC 2 cut(s) 342, 486
GsuI CTGGAG 1 cut(s) 436
HaeIII GGCC 1 cut(s) 537
Hin1II CATG 2 cut(s) 174, 359
HincII GTYRAC 2 cut(s) 277, 508
HindII GTYRAC 2 cut(s) 277, 508
HinfI GANTC 1 cut(s) 326
HphI GGTGA 3 cut(s) 49, 55, 317
Hpy166II GTNNAC 4 cut(s) 153, 277, 389, 508
Hpy188I TCNGA 2 cut(s) 461, 751
Hpy188III TCNNGA 4 cut(s) 263, 334, 440, 627
Hpy8I GTNNAC 4 cut(s) 153, 277, 389, 508
HpyAV CCTTC 2 cut(s) 300, 421
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4IV ACGT 3 cut(s) 145, 478, 523
HpyCH4V TGCA 1 cut(s) 498
HpyF3I CTNAG 7 cut(s) 27, 228, 249, 335, 393, 458, 748
HpySE526I ACGT 3 cut(s) 145, 478, 523
Hsp92II CATG 2 cut(s) 174, 359
Kzo9I GATC 3 cut(s) 330, 617, 677
LmnI GCTCC 1 cut(s) 4
Lsp1109I GCAGC 2 cut(s) 353, 472
LweI GCATC 2 cut(s) 8, 733
MaeI CTAG 1 cut(s) 591
MaeII ACGT 3 cut(s) 145, 478, 523
MalI GATC 3 cut(s) 332, 619, 679
MboI GATC 3 cut(s) 330, 617, 677
MfeI CAATTG 1 cut(s) 345
MflI RGATCY 1 cut(s) 677
MhlI GDGCHC 1 cut(s) 459
MluCI AATT 7 cut(s) 116, 211, 345, 499, 565, 652, 705
MlyI GAGTC 1 cut(s) 320
MmeI TCCRAC 1 cut(s) 148
MseI TTAA 1 cut(s) 581
MspA1I CMGCKG 1 cut(s) 397
MspR9I CCNGG 1 cut(s) 129
MunI CAATTG 1 cut(s) 345
MvaI CCWGG 1 cut(s) 129
NdeI CATATG 1 cut(s) 728
NdeII GATC 3 cut(s) 330, 617, 677
NlaIII CATG 2 cut(s) 174, 359
NspI RCATGY 1 cut(s) 174
NspV TTCGAA 1 cut(s) 650
PflMI CCANNNNNTGG 1 cut(s) 533
PkrI GCNGC 2 cut(s) 343, 487
PleI GAGTC 1 cut(s) 320
PpsI GAGTC 1 cut(s) 320
Ppu21I YACGTR 2 cut(s) 146, 479
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
PspPI GGNCC 1 cut(s) 536
PsuI RGATCY 1 cut(s) 677
RsaI GTAC 5 cut(s) 87, 144, 255, 390, 555
RsaNI GTAC 5 cut(s) 86, 143, 254, 389, 554
SaqAI TTAA 1 cut(s) 581
SatI GCNGC 2 cut(s) 342, 486
Sau3AI GATC 3 cut(s) 330, 617, 677
Sau96I GGNCC 1 cut(s) 536
SchI GAGTC 1 cut(s) 320
ScrFI CCNGG 1 cut(s) 129
SduI GDGCHC 1 cut(s) 459
SfaNI GCATC 2 cut(s) 8, 733
SfuI TTCGAA 1 cut(s) 650
SnaBI TACGTA 2 cut(s) 146, 479
Sse9I AATT 7 cut(s) 116, 211, 345, 499, 565, 652, 705
SsiI CCGC 1 cut(s) 397
SspMI CTAG 1 cut(s) 591
StyD4I CCNGG 1 cut(s) 127
StyI CCWWGG 1 cut(s) 590
TaaI ACNGT 1 cut(s) 181
TaiI ACGT 3 cut(s) 148, 481, 526
TaqI TCGA 3 cut(s) 262, 329, 650
TasI AATT 7 cut(s) 116, 211, 345, 499, 565, 652, 705
Tru1I TTAA 1 cut(s) 581
Tru9I TTAA 1 cut(s) 581
TscAI CASTG 1 cut(s) 35
TseI GCWGC 2 cut(s) 341, 485
TspDTI ATGAA 2 cut(s) 109, 680
TspGWI ACGGA 1 cut(s) 45
TspRI CASTG 1 cut(s) 35
Van91I CCANNNNNTGG 1 cut(s) 533
XapI RAATTY 1 cut(s) 705
XceI RCATGY 1 cut(s) 174
XmaJI CCTAGG 1 cut(s) 590
XspI CTAG 1 cut(s) 591
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.