Rmu_sc0004158.1_g000003

Domain associated at C-terminal with AAA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004158.1
OG0003681
Physical Location & Seq
Forward (+)
6538 .. 8108
1571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004158.1_g000003.1.cds

Sequence Viewer

Length: 1374 bp
ctggaccctctagccaatcacataactttcctcatcgacaactctagggatcactactcggacgaaatttcgcagcgcaacctagtctatgatgctgctgaggtctatcttgccaccaagatcaacccgaaaacccaaatctttcgaatcagcaaagcaccgaaacaaaaggtccccatcattgttgttaccaccacccaagaaatcgccgacactttcgaaaacattaaagtaaagtggcgcatgatcttccctgaagaaaaagaccgtcacagtcactacagtaggctcaataagagccgctttgagctaacattccacaggaaacacaaagacaaagttataaactcgtacatcgcctatgtattggctcgggccgaggctatcaaagatgcagaaaagactctaaagctttatagttacaatagtaaacgttcctcggcccattactttaaaccttctggtggacgctctcaaggtagtgatgacgatgatgactttgcaccttcttcaggcaattggagttgcgaggataatgagcacccagctactttcgagacaatagcaatggagccggagctaaagagaattatcatagatgatttggacaagttcgtgaagaggagggagttctacaagagagttggcaaggcttggaagagaggctacttgttgtttggtccccccggaactggaaaatccagcttggtagcggccatggctaatcatctccgttttgatatttatgatttggaactcactagcatttccagcaccgatcaattgaggaaggccttgatgtctactaccaatcgttctattgtggtgtttgaggatattgattgcagcaaggaatccgtaaaccgggaatcagcagagagcaagaactttatggtttccaaagccgaatccaaggtcataattacactctcgggtctgctgaatgtcgttgatggtctgtggtcaagttgcggtgatgagagaattattgtgttcaccaccaaccacaaggagcggctagaccctgcattgttgaggtctggtcgaatggatgtacacattcacatgtcgtattgcaccccaagagggttcaagaccttagcctcgaactacctcggcattcaggacaccagcgaacatcgcctgtgtggagaaattgaagcattgatagagaacacaaacatcacccctgcagaggtttgtgaggagcttatgaggggtgatggtgatgatgctgatgctgctcttgaaggacttgtcaattgcctcaagtgtaagaggctcgagaccaaaaaaatagaggaagaagaaatagggaaagcaaagaggcagaaaacagataacaatgcgtctgaaatttccgagaattggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA AAA_assoc

Protein Analysis

457

Amino Acids

52.06

Weight (kDa)

6.41

Isoelectric Point (pI)

50.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 344
AccBSI CCGCTC 1 cut(s) 1015
AccI GTMKAC 1 cut(s) 803
AciI CCGC 4 cut(s) 301, 713, 972, 1015
AclI AACGTT 1 cut(s) 433
AclWI GGATC 1 cut(s) 57
AcoI YGGCCR 1 cut(s) 714
AcsI RAATTY 2 cut(s) 66, 1356
AcuI CTGAAG 2 cut(s) 276, 495
AfaI GTAC 2 cut(s) 353, 1056
AfiI CCNNNNNNNGG 7 cut(s) 464, 512, 692, 864, 1086, 1195, 1368
AflIII ACRYGT 1 cut(s) 1065
AgsI TTSAA 3 cut(s) 1093, 1160, 1250
AluBI AGCT 6 cut(s) 310, 412, 548, 580, 705, 1210
AluI AGCT 6 cut(s) 310, 412, 548, 580, 705, 1210
Alw21I GWGCWC 1 cut(s) 543
Alw26I GTCTC 2 cut(s) 551, 1280
AlwI GGATC 1 cut(s) 57
Ama87I CYCGRG 3 cut(s) 372, 931, 1283
AoxI GGCC 4 cut(s) 375, 441, 714, 792
ApeKI GCWGC 4 cut(s) 73, 95, 846, 1241
ApoI RAATTY 2 cut(s) 66, 1356
ArsI GACNNNNNNTTYG 2 cut(s) 900, 932
AspLEI GCGC 2 cut(s) 78, 243
AspS9I GGNCC 5 cut(s) 4, 172, 375, 442, 680
AsuC2I CCSGG 2 cut(s) 687, 866
AsuHPI GGTGA 5 cut(s) 986, 988, 1177, 1232, 1238
AsuII TTCGAA 2 cut(s) 145, 219
AvaI CYCGRG 3 cut(s) 372, 931, 1283
AvaII GGWCC 3 cut(s) 4, 172, 680
BarI GAAGNNNNNNTAC 2 cut(s) 650, 682
Bbv12I GWGCWC 1 cut(s) 543
BbvCI CCTCAGC 1 cut(s) 99
BbvI GCAGC 4 cut(s) 82, 85, 858, 1228
BccI CCATC 3 cut(s) 185, 947, 1217
BcnI CCSGG 2 cut(s) 687, 866
BcoDI GTCTC 2 cut(s) 551, 1280
BfaI CTAG 5 cut(s) 11, 45, 83, 762, 1019
BfmI CTRYAG 2 cut(s) 280, 1191
BisI GCNGC 7 cut(s) 74, 96, 301, 714, 847, 1016, 1242
BlsI GCNGC 7 cut(s) 75, 97, 302, 715, 848, 1017, 1243
Bme1390I CCNGG 2 cut(s) 687, 866
Bme18I GGWCC 3 cut(s) 4, 172, 680
BmeT110I CYCGRG 3 cut(s) 372, 931, 1283
BmgT120I GGNCC 5 cut(s) 4, 172, 375, 442, 680
BmiI GGNNCC 4 cut(s) 6, 174, 573, 682
BmrFI CCNGG 2 cut(s) 687, 866
BmsI GCATC 4 cut(s) 82, 382, 1222, 1228
Bpu10I CCTNAGC 2 cut(s) 99, 1099
Bpu14I TTCGAA 2 cut(s) 145, 219
BpuEI CTTGAG 2 cut(s) 459, 1253
BpuMI CCSGG 2 cut(s) 687, 866
BsaI GGTCTC 1 cut(s) 1280
BsaJI CCNNGG 6 cut(s) 378, 438, 685, 717, 912, 1114
Bsc4I CCNNNNNNNGG 7 cut(s) 464, 512, 692, 864, 1086, 1195, 1368
Bse1I ACTGG 1 cut(s) 697
Bse3DI GCAATG 1 cut(s) 573
BseDI CCNNGG 6 cut(s) 378, 438, 685, 717, 912, 1114
BseGI GGATG 1 cut(s) 1057
BseLI CCNNNNNNNGG 7 cut(s) 464, 512, 692, 864, 1086, 1195, 1368
BseMI GCAATG 1 cut(s) 573
BseMII CTCAG 1 cut(s) 90
BseNI ACTGG 1 cut(s) 697
BseRI GAGGAG 2 cut(s) 637, 1220
BseXI GCAGC 4 cut(s) 82, 85, 858, 1228
BseYI CCCAGC 1 cut(s) 544
BshFI GGCC 4 cut(s) 377, 443, 716, 794
BsiHKAI GWGCWC 1 cut(s) 543
BsiHKCI CYCGRG 3 cut(s) 372, 931, 1283
BsiSI CCGG 3 cut(s) 575, 687, 865
BslFI GGGAC 2 cut(s) 158, 666
BslI CCNNNNNNNGG 7 cut(s) 464, 512, 692, 864, 1086, 1195, 1368
BsmAI GTCTC 2 cut(s) 551, 1280
BsmFI GGGAC 2 cut(s) 158, 666
BsmI GAATGC 1 cut(s) 1119
BsnI GGCC 4 cut(s) 377, 443, 716, 794
Bso31I GGTCTC 1 cut(s) 1280
BsoBI CYCGRG 3 cut(s) 372, 931, 1283
Bsp119I TTCGAA 2 cut(s) 145, 219
Bsp1286I GDGCHC 1 cut(s) 543
Bsp1407I TGTACA 1 cut(s) 1054
Bsp143I GATC 4 cut(s) 49, 120, 246, 778
Bsp19I CCATGG 1 cut(s) 717
BspACI CCGC 4 cut(s) 301, 713, 972, 1015
BspANI GGCC 4 cut(s) 377, 443, 716, 794
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 4 cut(s) 6, 174, 573, 682
BspMAI CTGCAG 1 cut(s) 1195
BspPI GGATC 1 cut(s) 57
BspT104I TTCGAA 2 cut(s) 145, 219
BspTNI GGTCTC 1 cut(s) 1280
BsrBI CCGCTC 1 cut(s) 1015
BsrDI GCAATG 1 cut(s) 573
BsrGI TGTACA 1 cut(s) 1054
BsrI ACTGG 1 cut(s) 697
BssECI CCNNGG 6 cut(s) 378, 438, 685, 717, 912, 1114
BssMI GATC 4 cut(s) 49, 120, 246, 778
BssT1I CCWWGG 2 cut(s) 717, 912
Bst4CI ACNGT 3 cut(s) 269, 275, 284
Bst6I CTCTTC 2 cut(s) 614, 653
BstAUI TGTACA 1 cut(s) 1054
BstBI TTCGAA 2 cut(s) 145, 219
BstDEI CTNAG 2 cut(s) 99, 1099
BstDSI CCRYGG 1 cut(s) 717
BstENI CCTNNNNNAGG 1 cut(s) 510
BstF5I GGATG 1 cut(s) 1057
BstHHI GCGC 2 cut(s) 78, 243
BstKTI GATC 4 cut(s) 52, 123, 249, 781
BstMAI GTCTC 2 cut(s) 551, 1280
BstMBI GATC 4 cut(s) 49, 120, 246, 778
BstMWI GCNNNNNNNGC 4 cut(s) 719, 771, 1140, 1241
BstNSI RCATGY 1 cut(s) 1069
BstSCI CCNGG 2 cut(s) 685, 864
BstSFI CTRYAG 2 cut(s) 280, 1191
BstV1I GCAGC 4 cut(s) 82, 85, 858, 1228
BsuRI GGCC 4 cut(s) 377, 443, 716, 794
BtgI CCRYGG 1 cut(s) 717
BtgZI GCGATG 2 cut(s) 340, 1124
BtsCI GGATG 1 cut(s) 1057
CfoI GCGC 2 cut(s) 78, 243
Cfr13I GGNCC 5 cut(s) 4, 172, 375, 442, 680
CseI GACGC 2 cut(s) 477, 1338
Csp6I GTAC 2 cut(s) 352, 1055
CviAII CATG 3 cut(s) 244, 718, 1066
CviQI GTAC 2 cut(s) 352, 1055
DdeI CTNAG 2 cut(s) 99, 1099
DpnI GATC 4 cut(s) 51, 122, 248, 780
DpnII GATC 4 cut(s) 49, 120, 246, 778
DraI TTTAAA 1 cut(s) 454
EaeI YGGCCR 1 cut(s) 714
Eam1104I CTCTTC 2 cut(s) 614, 653
EarI CTCTTC 2 cut(s) 614, 653
Eco130I CCWWGG 2 cut(s) 717, 912
Eco147I AGGCCT 1 cut(s) 794
Eco31I GGTCTC 1 cut(s) 1280
Eco47I GGWCC 3 cut(s) 4, 172, 680
Eco57I CTGAAG 2 cut(s) 276, 495
Eco88I CYCGRG 3 cut(s) 372, 931, 1283
EcoNI CCTNNNNNAGG 1 cut(s) 510
EcoO109I RGGNCCY 1 cut(s) 172
EcoT14I CCWWGG 2 cut(s) 717, 912
ErhI CCWWGG 2 cut(s) 717, 912
FaeI CATG 3 cut(s) 247, 721, 1069
FalI AAGNNNNNCTT 2 cut(s) 287, 319
FaqI GGGAC 2 cut(s) 158, 666
FatI CATG 3 cut(s) 243, 717, 1065
FblI GTMKAC 1 cut(s) 803
Fnu4HI GCNGC 7 cut(s) 74, 96, 301, 714, 847, 1016, 1242
FokI GGATG 1 cut(s) 1064
Fsp4HI GCNGC 7 cut(s) 74, 96, 301, 714, 847, 1016, 1242
FspBI CTAG 5 cut(s) 11, 45, 83, 762, 1019
GlaI GCGC 2 cut(s) 77, 242
GluI GCNGC 7 cut(s) 74, 96, 301, 714, 847, 1016, 1242
GsaI CCCAGC 1 cut(s) 548
HaeIII GGCC 4 cut(s) 377, 443, 716, 794
HapII CCGG 3 cut(s) 575, 687, 865
HgaI GACGC 2 cut(s) 477, 1338
HhaI GCGC 2 cut(s) 78, 243
Hin1II CATG 3 cut(s) 247, 721, 1069
Hin6I GCGC 2 cut(s) 76, 241
HinP1I GCGC 2 cut(s) 76, 241
HindIII AAGCTT 1 cut(s) 410
HinfI GANTC 5 cut(s) 147, 403, 854, 869, 908
HpaII CCGG 3 cut(s) 575, 687, 865
HphI GGTGA 5 cut(s) 986, 988, 1177, 1232, 1238
Hpy166II GTNNAC 6 cut(s) 431, 467, 804, 862, 996, 1057
Hpy188I TCNGA 3 cut(s) 61, 1354, 1363
Hpy188III TCNNGA 6 cut(s) 556, 616, 1093, 1124, 1247, 1285
Hpy8I GTNNAC 6 cut(s) 431, 467, 804, 862, 996, 1057
HpyAV CCTTC 4 cut(s) 468, 516, 784, 1244
HpyCH4III ACNGT 3 cut(s) 269, 275, 284
HpyCH4IV ACGT 1 cut(s) 433
HpyCH4V TGCA 6 cut(s) 395, 503, 846, 1028, 1077, 1193
HpyF10VI GCNNNNNNNGC 4 cut(s) 719, 771, 1140, 1241
HpyF3I CTNAG 2 cut(s) 99, 1099
HpySE526I ACGT 1 cut(s) 433
Hsp92II CATG 3 cut(s) 247, 721, 1069
HspAI GCGC 2 cut(s) 76, 241
Kzo9I GATC 4 cut(s) 49, 120, 246, 778
LmnI GCTCC 4 cut(s) 571, 577, 1012, 1207
Lsp1109I GCAGC 4 cut(s) 82, 85, 858, 1228
LweI GCATC 4 cut(s) 82, 382, 1222, 1228
MaeI CTAG 5 cut(s) 11, 45, 83, 762, 1019
MaeII ACGT 1 cut(s) 433
MaeIII GTNAC 4 cut(s) 187, 269, 275, 419
MalI GATC 4 cut(s) 51, 122, 248, 780
MbiI CCGCTC 1 cut(s) 1015
MboI GATC 4 cut(s) 49, 120, 246, 778
MboII GAAGA 7 cut(s) 241, 269, 501, 631, 670, 1316, 1319
MfeI CAATTG 3 cut(s) 517, 782, 1261
MhlI GDGCHC 1 cut(s) 543
MlyI GAGTC 1 cut(s) 397
MseI TTAA 2 cut(s) 228, 453
MslI CAYNNNNRTG 1 cut(s) 1064
MspI CCGG 3 cut(s) 575, 687, 865
MspR9I CCNGG 2 cut(s) 687, 866
MunI CAATTG 3 cut(s) 517, 782, 1261
Mva1269I GAATGC 1 cut(s) 1119
MwoI GCNNNNNNNGC 4 cut(s) 719, 771, 1140, 1241
NciI CCSGG 2 cut(s) 687, 866
NcoI CCATGG 1 cut(s) 717
NdeII GATC 4 cut(s) 49, 120, 246, 778
NlaIII CATG 3 cut(s) 247, 721, 1069
NlaIV GGNNCC 4 cut(s) 6, 174, 573, 682
NmeAIII GCCGAG 3 cut(s) 403, 419, 1095
NmuCI GTSAC 2 cut(s) 269, 275
NspI RCATGY 1 cut(s) 1069
NspV TTCGAA 2 cut(s) 145, 219
PaeR7I CTCGAG 1 cut(s) 1283
PceI AGGCCT 1 cut(s) 794
PciI ACATGT 1 cut(s) 1065
PctI GAATGC 1 cut(s) 1119
PfeI GAWTC 4 cut(s) 147, 854, 869, 908
PkrI GCNGC 7 cut(s) 75, 97, 302, 715, 848, 1017, 1243
PleI GAGTC 1 cut(s) 397
PpsI GAGTC 1 cut(s) 397
PpuMI RGGWCCY 1 cut(s) 172
PscI ACATGT 1 cut(s) 1065
PsiI TTATAA 1 cut(s) 344
Psp1406I AACGTT 1 cut(s) 433
Psp5II RGGWCCY 1 cut(s) 172
PspFI CCCAGC 1 cut(s) 544
PspN4I GGNNCC 4 cut(s) 6, 174, 573, 682
PspPI GGNCC 5 cut(s) 4, 172, 375, 442, 680
PspPPI RGGWCCY 1 cut(s) 172
PstI CTGCAG 1 cut(s) 1195
RsaI GTAC 2 cut(s) 353, 1056
RsaNI GTAC 2 cut(s) 352, 1055
RseI CAYNNNNRTG 1 cut(s) 1064
SaqAI TTAA 2 cut(s) 228, 453
SatI GCNGC 7 cut(s) 74, 96, 301, 714, 847, 1016, 1242
Sau3AI GATC 4 cut(s) 49, 120, 246, 778
Sau96I GGNCC 5 cut(s) 4, 172, 375, 442, 680
SchI GAGTC 1 cut(s) 397
ScrFI CCNGG 2 cut(s) 687, 866
SduI GDGCHC 1 cut(s) 543
SfaNI GCATC 4 cut(s) 82, 382, 1222, 1228
SfcI CTRYAG 2 cut(s) 280, 1191
Sfr274I CTCGAG 1 cut(s) 1283
SfuI TTCGAA 2 cut(s) 145, 219
SinI GGWCC 3 cut(s) 4, 172, 680
SlaI CTCGAG 1 cut(s) 1283
SmiMI CAYNNNNRTG 1 cut(s) 1064
SmlI CTYRAG 3 cut(s) 474, 1268, 1283
SmoI CTYRAG 3 cut(s) 474, 1268, 1283
SseBI AGGCCT 1 cut(s) 794
SsiI CCGC 4 cut(s) 301, 713, 972, 1015
SspMI CTAG 5 cut(s) 11, 45, 83, 762, 1019
StuI AGGCCT 1 cut(s) 794
StyD4I CCNGG 2 cut(s) 685, 864
StyI CCWWGG 2 cut(s) 717, 912
TaaI ACNGT 3 cut(s) 269, 275, 284
TaiI ACGT 1 cut(s) 436
TaqI TCGA 7 cut(s) 36, 145, 219, 555, 1045, 1106, 1284
TatI WGTACW 1 cut(s) 1054
TauI GCSGC 3 cut(s) 303, 716, 1018
TfiI GAWTC 4 cut(s) 147, 854, 869, 908
Tru1I TTAA 2 cut(s) 228, 453
Tru9I TTAA 2 cut(s) 228, 453
TseFI GTSAC 2 cut(s) 269, 275
TseI GCWGC 4 cut(s) 73, 95, 846, 1241
Tsp45I GTSAC 2 cut(s) 269, 275
TspGWI ACGGA 2 cut(s) 722, 847
VpaK11BI GGWCC 3 cut(s) 4, 172, 680
XagI CCTNNNNNAGG 1 cut(s) 510
XapI RAATTY 2 cut(s) 66, 1356
XceI RCATGY 1 cut(s) 1069
XhoI CTCGAG 1 cut(s) 1283
XmiI GTMKAC 1 cut(s) 803
XspI CTAG 5 cut(s) 11, 45, 83, 762, 1019
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.