Rmu_sc0005114.1_g000014

At1g01500-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005114.1
Physical Location & Seq
Reverse (-)
30140 .. 33018
2879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005114.1_g000014.1.cds

Sequence Viewer

Length: 852 bp
atggaaaattcttatgagacatcaaacagccacacacctattttcaatggttatgcacctacttcaaatggccatggacctatttcaaatggtcgtgggtcaactggtggtggccacatgattgggagacaatccacctaccaacccaaggtgtcactactaccttggcttgatgtaagagttttctatgttaggattagcaaatgtgagattgatgattcggctccagaattcctcacggtaaatcacattccattggatgctgatacccttcttgaagtcaatggtgttagaactagcatgtattcagatggggaaacaactcttcttcgaagagaccggttagataagaagtcagaagaagctacgtttgtcagcactgatagtataaggatgactggaagtgtgaagtttgaggtttttgacaaggatgttattgtgctatctggggttttagagttgtgtaataatattggtttcattgcggaaacagatcatcatggtccgagatggagcatgaattgtgaaacaaatataattgcaagcactggcttctttaaaccaaagcagtttacgggttcagagtctgcaacaccttcaattgaagtatacattgcagggtccttcttgggaactccaataattctaacaaagactttacagctgagtccttggaagaagcatacgaggaaggggttattggattcaataccagagtatgatgcaactgaagacgagaacaataatccttctatgttcatgtttcagaggaaacaagcaagaaacttgatcattcaggtgggaaatgcatctatgtgcactacagcactcaaactaaaggctgagcactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

283

Amino Acids

31.4

Weight (kDa)

5.92

Isoelectric Point (pI)

34.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 609
AciI CCGC 1 cut(s) 485
AcoI YGGCCR 2 cut(s) 70, 112
AcsI RAATTY 2 cut(s) 7, 230
AcuI CTGAAG 1 cut(s) 750
AfiI CCNNNNNNNGG 1 cut(s) 148
AgeI ACCGGT 1 cut(s) 339
AgsI TTSAA 7 cut(s) 46, 66, 87, 278, 600, 605, 708
AjuI GAANNNNNNNTTGG 2 cut(s) 683, 715
AluBI AGCT 2 cut(s) 365, 664
AluI AGCT 2 cut(s) 365, 664
Alw21I GWGCWC 2 cut(s) 821, 849
Alw26I GTCTC 3 cut(s) 11, 121, 330
Alw44I GTGCAC 1 cut(s) 817
AlwNI CAGNNNCTG 1 cut(s) 587
AoxI GGCC 2 cut(s) 70, 112
ApaLI GTGCAC 1 cut(s) 817
ApoI RAATTY 2 cut(s) 7, 230
AsiGI ACCGGT 1 cut(s) 339
AspS9I GGNCC 3 cut(s) 77, 503, 621
AsuII TTCGAA 1 cut(s) 331
AvaII GGWCC 3 cut(s) 77, 503, 621
BaeGI GKGCMC 1 cut(s) 821
BalI TGGCCA 2 cut(s) 72, 114
BbsI GAAGAC 1 cut(s) 738
Bbv12I GWGCWC 2 cut(s) 821, 849
BccI CCATC 2 cut(s) 305, 504
BclI TGATCA 1 cut(s) 789
BcoDI GTCTC 3 cut(s) 11, 121, 330
BfaI CTAG 2 cut(s) 297, 850
BfmI CTRYAG 1 cut(s) 822
BlpI GCTNAGC 1 cut(s) 843
Bme18I GGWCC 3 cut(s) 77, 503, 621
BmgT120I GGNCC 3 cut(s) 77, 503, 621
BmiI GGNNCC 2 cut(s) 225, 622
BmsI GCATC 3 cut(s) 250, 712, 818
BpiI GAAGAC 1 cut(s) 738
BpmI CTGGAG 1 cut(s) 210
Bpu1102I GCTNAGC 1 cut(s) 843
Bpu14I TTCGAA 1 cut(s) 331
BsaI GGTCTC 1 cut(s) 330
BsaJI CCNNGG 4 cut(s) 73, 147, 164, 671
BsaWI WCCGGW 1 cut(s) 339
Bsc4I CCNNNNNNNGG 1 cut(s) 148
Bse118I RCCGGY 1 cut(s) 339
Bse1I ACTGG 3 cut(s) 109, 403, 553
Bse3DI GCAATG 2 cut(s) 480, 612
BseDI CCNNGG 4 cut(s) 73, 147, 164, 671
BseGI GGATG 3 cut(s) 265, 399, 436
BseLI CCNNNNNNNGG 1 cut(s) 148
BseMI GCAATG 2 cut(s) 480, 612
BseMII CTCAG 2 cut(s) 656, 834
BseNI ACTGG 3 cut(s) 109, 403, 553
BseSI GKGCMC 1 cut(s) 821
BshFI GGCC 2 cut(s) 72, 114
BshTI ACCGGT 1 cut(s) 339
BsiHKAI GWGCWC 2 cut(s) 821, 849
BsiSI CCGG 1 cut(s) 340
BslI CCNNNNNNNGG 1 cut(s) 148
BsmAI GTCTC 3 cut(s) 11, 121, 330
BsnI GGCC 2 cut(s) 72, 114
Bso31I GGTCTC 1 cut(s) 330
Bsp119I TTCGAA 1 cut(s) 331
Bsp1286I GDGCHC 2 cut(s) 821, 849
Bsp143I GATC 2 cut(s) 493, 789
Bsp1720I GCTNAGC 1 cut(s) 843
Bsp19I CCATGG 1 cut(s) 73
BspACI CCGC 1 cut(s) 485
BspANI GGCC 2 cut(s) 72, 114
BspCNI CTCAG 2 cut(s) 657, 835
BspLI GGNNCC 2 cut(s) 225, 622
BspT104I TTCGAA 1 cut(s) 331
BspTNI GGTCTC 1 cut(s) 330
BsrDI GCAATG 2 cut(s) 480, 612
BsrFI RCCGGY 1 cut(s) 339
BsrI ACTGG 3 cut(s) 109, 403, 553
BssAI RCCGGY 1 cut(s) 339
BssECI CCNNGG 4 cut(s) 73, 147, 164, 671
BssMI GATC 2 cut(s) 493, 789
BssNAI GTATAC 1 cut(s) 610
BssT1I CCWWGG 4 cut(s) 73, 147, 164, 671
Bst1107I GTATAC 1 cut(s) 610
Bst4CI ACNGT 1 cut(s) 241
Bst6I CTCTTC 2 cut(s) 328, 330
BstBI TTCGAA 1 cut(s) 331
BstC8I GCNNGC 1 cut(s) 544
BstDEI CTNAG 2 cut(s) 665, 843
BstDSI CCRYGG 1 cut(s) 73
BstF5I GGATG 3 cut(s) 265, 399, 436
BstKTI GATC 2 cut(s) 496, 792
BstMAI GTCTC 3 cut(s) 11, 121, 330
BstMBI GATC 2 cut(s) 493, 789
BstNSI RCATGY 1 cut(s) 304
BstSFI CTRYAG 1 cut(s) 822
BstSLI GKGCMC 1 cut(s) 821
BstV2I GAAGAC 1 cut(s) 738
BstXI CCANNNNNNTGG 1 cut(s) 122
BstZ17I GTATAC 1 cut(s) 610
BsuRI GGCC 2 cut(s) 72, 114
BtgI CCRYGG 1 cut(s) 73
BtsCI GGATG 3 cut(s) 265, 399, 436
BtsIMutI CAGTG 2 cut(s) 378, 546
Cac8I GCNNGC 1 cut(s) 544
CaiI CAGNNNCTG 1 cut(s) 587
Cfr10I RCCGGY 1 cut(s) 339
Cfr13I GGNCC 3 cut(s) 77, 503, 621
CspAI ACCGGT 1 cut(s) 339
CviAII CATG 6 cut(s) 74, 118, 301, 500, 517, 760
CviJI RGCY 9 cut(s) 30, 72, 114, 169, 224, 365, 552, 664, 842
CviKI_1 RGCY 9 cut(s) 30, 72, 114, 169, 224, 365, 552, 664, 842
DdeI CTNAG 2 cut(s) 665, 843
DpnI GATC 2 cut(s) 495, 791
DpnII GATC 2 cut(s) 493, 789
DraI TTTAAA 1 cut(s) 559
EaeI YGGCCR 2 cut(s) 70, 112
Eam1104I CTCTTC 2 cut(s) 328, 330
EarI CTCTTC 2 cut(s) 328, 330
Eco130I CCWWGG 4 cut(s) 73, 147, 164, 671
Eco31I GGTCTC 1 cut(s) 330
Eco47I GGWCC 3 cut(s) 77, 503, 621
Eco57I CTGAAG 1 cut(s) 750
EcoO109I RGGNCCY 1 cut(s) 621
EcoRI GAATTC 1 cut(s) 230
EcoT14I CCWWGG 4 cut(s) 73, 147, 164, 671
EcoT22I ATGCAT 1 cut(s) 811
ErhI CCWWGG 4 cut(s) 73, 147, 164, 671
FaeI CATG 6 cut(s) 77, 121, 304, 503, 520, 763
FatI CATG 6 cut(s) 73, 117, 300, 499, 516, 759
FbaI TGATCA 1 cut(s) 789
FblI GTMKAC 1 cut(s) 609
FokI GGATG 3 cut(s) 272, 406, 443
FspBI CTAG 2 cut(s) 297, 850
GsuI CTGGAG 1 cut(s) 210
HaeIII GGCC 2 cut(s) 72, 114
HapII CCGG 1 cut(s) 340
Hin1II CATG 6 cut(s) 77, 121, 304, 503, 520, 763
HincII GTYRAC 1 cut(s) 102
HindII GTYRAC 1 cut(s) 102
HinfI GANTC 4 cut(s) 218, 584, 667, 704
HpaII CCGG 1 cut(s) 340
Hpy166II GTNNAC 4 cut(s) 102, 573, 610, 819
Hpy188I TCNGA 5 cut(s) 310, 358, 507, 583, 768
Hpy188III TCNNGA 2 cut(s) 227, 275
Hpy8I GTNNAC 4 cut(s) 102, 573, 610, 819
HpyAV CCTTC 5 cut(s) 281, 606, 634, 685, 759
HpyCH4III ACNGT 1 cut(s) 241
HpyCH4IV ACGT 1 cut(s) 368
HpyCH4V TGCA 7 cut(s) 56, 542, 590, 617, 725, 809, 819
HpyF3I CTNAG 2 cut(s) 665, 843
HpySE526I ACGT 1 cut(s) 368
Hsp92II CATG 6 cut(s) 77, 121, 304, 503, 520, 763
Ksp22I TGATCA 1 cut(s) 789
Kzo9I GATC 2 cut(s) 493, 789
LmnI GCTCC 2 cut(s) 229, 513
LpnPI CCDG 9 cut(s) 90, 240, 353, 384, 432, 534, 603, 726, 782
LweI GCATC 3 cut(s) 250, 712, 818
MaeI CTAG 2 cut(s) 297, 850
MaeII ACGT 1 cut(s) 368
MaeIII GTNAC 1 cut(s) 153
MalI GATC 2 cut(s) 495, 791
MboI GATC 2 cut(s) 493, 789
MboII GAAGA 6 cut(s) 317, 320, 345, 371, 688, 743
MfeI CAATTG 1 cut(s) 600
MhlI GDGCHC 2 cut(s) 821, 849
MlsI TGGCCA 2 cut(s) 72, 114
MluCI AATT 6 cut(s) 7, 230, 520, 537, 600, 642
MluNI TGGCCA 2 cut(s) 72, 114
MlyI GAGTC 2 cut(s) 593, 676
MnlI CCTC 4 cut(s) 245, 409, 681, 762
Mox20I TGGCCA 2 cut(s) 72, 114
Mph1103I ATGCAT 1 cut(s) 811
MscI TGGCCA 2 cut(s) 72, 114
MseI TTAA 1 cut(s) 558
MslI CAYNNNNRTG 2 cut(s) 797, 814
Msp20I TGGCCA 2 cut(s) 72, 114
MspA1I CMGCKG 1 cut(s) 664
MspI CCGG 1 cut(s) 340
MunI CAATTG 1 cut(s) 600
NcoI CCATGG 1 cut(s) 73
NdeII GATC 2 cut(s) 493, 789
NlaIII CATG 6 cut(s) 77, 121, 304, 503, 520, 763
NlaIV GGNNCC 2 cut(s) 225, 622
NmuCI GTSAC 1 cut(s) 153
NsiI ATGCAT 1 cut(s) 811
NspI RCATGY 1 cut(s) 304
NspV TTCGAA 1 cut(s) 331
PfeI GAWTC 2 cut(s) 218, 704
PinAI ACCGGT 1 cut(s) 339
PleI GAGTC 2 cut(s) 592, 675
PpsI GAGTC 2 cut(s) 592, 675
PpuMI RGGWCCY 1 cut(s) 621
Psp5II RGGWCCY 1 cut(s) 621
PspN4I GGNNCC 2 cut(s) 225, 622
PspPI GGNCC 3 cut(s) 77, 503, 621
PspPPI RGGWCCY 1 cut(s) 621
PstNI CAGNNNCTG 1 cut(s) 587
PvuII CAGCTG 1 cut(s) 664
RseI CAYNNNNRTG 2 cut(s) 797, 814
SaqAI TTAA 1 cut(s) 558
Sau3AI GATC 2 cut(s) 493, 789
Sau96I GGNCC 3 cut(s) 77, 503, 621
SchI GAGTC 2 cut(s) 593, 676
SduI GDGCHC 2 cut(s) 821, 849
SfaNI GCATC 3 cut(s) 250, 712, 818
SfcI CTRYAG 1 cut(s) 822
SfuI TTCGAA 1 cut(s) 331
SinI GGWCC 3 cut(s) 77, 503, 621
SmiMI CAYNNNNRTG 2 cut(s) 797, 814
Sse9I AATT 6 cut(s) 7, 230, 520, 537, 600, 642
SsiI CCGC 1 cut(s) 485
SspI AATATT 1 cut(s) 472
SspMI CTAG 2 cut(s) 297, 850
StyI CCWWGG 4 cut(s) 73, 147, 164, 671
TaaI ACNGT 1 cut(s) 241
TaiI ACGT 1 cut(s) 371
TaqI TCGA 1 cut(s) 331
TasI AATT 6 cut(s) 7, 230, 520, 537, 600, 642
TfiI GAWTC 2 cut(s) 218, 704
Tru1I TTAA 1 cut(s) 558
Tru9I TTAA 1 cut(s) 558
TscAI CASTG 2 cut(s) 385, 553
TseFI GTSAC 1 cut(s) 153
Tsp45I GTSAC 1 cut(s) 153
TspDTI ATGAA 3 cut(s) 469, 533, 748
TspRI CASTG 2 cut(s) 385, 553
VneI GTGCAC 1 cut(s) 817
VpaK11BI GGWCC 3 cut(s) 77, 503, 621
XapI RAATTY 2 cut(s) 7, 230
XceI RCATGY 1 cut(s) 304
XmiI GTMKAC 1 cut(s) 609
XspI CTAG 2 cut(s) 297, 850
Zsp2I ATGCAT 1 cut(s) 811
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.