Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005268.1

Orthogroup ID

OG0002046

Physical Location & Seq

Genomic Coordinates Forward (+)

61067 .. 63384

Gene Structure 2318 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005268.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1479 bp

atggaaacacagacagtacccttgctgatcatcaaacctaaatcagatgagactgaagactatgtgccggtgagtagctttgaggaggcctttttggtcttttggaaagagacagtgaagctgtggaagattgcagctccagttgcaataacaatgttgtttcagtacttgattcaatctgtcaccaccatatttgtaggccatctcggagaccttgaactctctgctgtttcactggctcacaatgtcattggcaacatctcttatggtttcctgcaaggtatggcaattgcattgggaacactttgtggtcaagcatatggtgcaggccaagttggttcacttggtatctatttgcagcgctcatggattgtcctatccatcacttctgtgatcctttcatcagcttatatatatgcaactccaatcctaatgatcttaggccaagaccctcatatagctaatcttgccggaaaatatagcaggaagtttcttcctgaaatgttctcttctactctcaatttgtccacccaaaagttccttcaggctcaaagcaaggtcggcgtgatcacatggatggcctttgcagctctcattgcacaaactggacttcttcatctcttcatcaacgttttcgggtggggattaagtggtgcagctgcagcatacaacataacaaattggggaattgcaattggtcaaggtgtgtattgtgtgttctggtgccaagaggcttggaatactggattttcatggttggcatttaaggacatttgggtttttgcaaagctttcctttgcttcgtgcttcatgttttgcttcgagttatggtatgtcatgagtgtgaacattctcattggtgtccttccaaatgcagtgattgctcttggttccttctctatatgcacgaactttcagaattgggagctcatgttgttggttggagtaaatgctgccataagcattcgagtctccaatgaactagggatggggcacccaagaaccgcaaagtactcagtgtgtgttgctgtctcgcaatctctcatggttgggatcgtgtccatgattattatcttcattaccagaaactacattcccattgtcttcacagacagtgaagatatgcaacgagccgttgctcgtttagcataccttcttggtgtaaccatgcttctcaatagtgctacacaagtgttaacaggtgttgctgttggaggtggatggcaggtgatggtagcttatataaatttgggttgttattatttgtttggtcttccacttgcaatccttcttgggtttaaagcaaatctaggtgccatgggactatggggtggcatgatgagtggaagtgctcttcaaatcctgttcctactgattctgacttctagaaccaactgggacaatgaggtggagcagaccacaaagcgcataaggaagtgggggaaccaagaaaaggagactcagaatatagcttgctga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

MatE

Protein Analysis

492

Amino Acids

54.04

Weight (kDa)

7.51

Isoelectric Point (pI)

31.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002046)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g15630 FvH4_7g30024 FvH4_7g30070 FvH4_7g30070 FvH4_7g30070 FvH4_7g30072 FvH4_7g30073
malus_domestica	MD01G1206400.v1.1 MD07G1277100.v1.1
pyrus_communis	pycom01g21630 pycom07g25200
rosa_chinensis	RchiOBHm_Chr1g0378011 RchiOBHm_Chr1g0378051
rosa_laevigata	RLG00000026477 RLG00000026478
rosa_multiflora	Rmu_co8476257.1_g000001 Rmu_sc0002068.1_g000001 Rmu_sc0002068.1_g000002 Rmu_sc0005268.1_g000013
rosa_roxburghii	Rroxscaffold_156G00440340 Rroxscaffold_156G00440350 Rroxscaffold_156G00440370 Rroxscaffold_156G00440410 Rroxscaffold_4G00280820 Rroxscaffold_4G00280830 Rroxscaffold_4G00280840
rosa_samantha	Rh1AG424600 Rh1AG425000 Rh1AG425100 Rh1BG383700 Rh1BG384300 Rh1BG384600 Rh1CG397400 Rh1CG398000 Rh1CG398100 Rh1CG398200 Rh1CG398600 Rh1DG414700 Rh1DG415500 Rh1DG415600 Rh1DG415700 Rh1DG415900
rosa_wichuraiana	Rw0G014950 Rw1G037320 Rw1G037340

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	1216
Acc36I	ACCTGC	1 cut(s)	1216
AccB1I	GGYRCC	3 cut(s)	723, 993, 1313
AciI	CCGC	1 cut(s)	1005
AclI	AACGTT	1 cut(s)	630
AclWI	GGATC	2 cut(s)	388, 1061
AcsI	RAATTY	1 cut(s)	1246
AcuI	CTGAAG	2 cut(s)	75, 527
AdeI	CACNNNGTG	1 cut(s)	308
AfaI	GTAC	3 cut(s)	18, 167, 1013
AfeI	AGCGCT	1 cut(s)	362
AfiI	CCNNNNNNNGG	1 cut(s)	1453
AgsI	TTSAA	3 cut(s)	176, 218, 1358
AjuI	GAANNNNNNNTTGG	2 cut(s)	525, 557
AleI	CACNNNNGTG	1 cut(s)	389
Alw21I	GWGCWC	2 cut(s)	930, 1354
Alw26I	GTCTC	6 cut(s)	44, 104, 204, 976, 1036, 1451
AlwI	GGATC	2 cut(s)	388, 1061
Aor51HI	AGCGCT	1 cut(s)	362
AoxI	GGCC	5 cut(s)	87, 199, 328, 442, 579
ApeKI	GCWGC	7 cut(s)	134, 358, 587, 656, 659, 662, 953
ApoI	RAATTY	1 cut(s)	1246
AspLEI	GCGC	2 cut(s)	363, 1428
AsuHPI	GGTGA	3 cut(s)	82, 175, 1240
BaeGI	GKGCMC	1 cut(s)	996
BanI	GGYRCC	3 cut(s)	723, 993, 1313
BanII	GRGCYC	1 cut(s)	930
BarI	GAAGNNNNNNTAC	2 cut(s)	1155, 1187
BbsI	GAAGAC	3 cut(s)	63, 1096, 1265
Bbv12I	GWGCWC	2 cut(s)	930, 1354
BbvI	GCAGC	7 cut(s)	146, 370, 599, 646, 668, 674, 940
BccI	CCATC	6 cut(s)	210, 389, 571, 982, 1215, 1225
BceAI	ACGGC	1 cut(s)	1118
BclI	TGATCA	2 cut(s)	27, 567
BcoDI	GTCTC	6 cut(s)	44, 104, 204, 976, 1036, 1451
BfaI	CTAG	3 cut(s)	983, 1310, 1386
BfmI	CTRYAG	1 cut(s)	660
BfoI	RGCGCY	1 cut(s)	364
BfuAI	ACCTGC	1 cut(s)	1216
BisI	GCNGC	7 cut(s)	135, 359, 588, 657, 660, 663, 954
BlsI	GCNGC	7 cut(s)	136, 360, 589, 658, 661, 664, 955
BmcAI	AGTACT	2 cut(s)	167, 1013
BmiI	GGNNCC	5 cut(s)	725, 892, 995, 1315, 1445
BmrI	ACTGGG	1 cut(s)	1405
BmuI	ACTGGG	1 cut(s)	1405
BpiI	GAAGAC	3 cut(s)	63, 1096, 1265
BpmI	CTGGAG	1 cut(s)	123
BsaBI	GATNNNNATC	1 cut(s)	1070
BsaI	GGTCTC	1 cut(s)	204
BsaJI	CCNNGG	1 cut(s)	1317
BsaXI	ACNNNNNCTCC	2 cut(s)	917, 947
Bsc4I	CCNNNNNNNGG	1 cut(s)	1453
Bse118I	RCCGGY	1 cut(s)	67
Bse1I	ACTGG	5 cut(s)	140, 240, 610, 748, 1400
Bse3DI	GCAATG	1 cut(s)	594
Bse8I	GATNNNNATC	1 cut(s)	1070
BseDI	CCNNGG	1 cut(s)	1317
BseGI	GGATG	3 cut(s)	582, 993, 1226
BseJI	GATNNNNATC	1 cut(s)	1070
BseLI	CCNNNNNNNGG	1 cut(s)	1453
BseMI	GCAATG	1 cut(s)	594
BseMII	CTCAG	2 cut(s)	1029, 1475
BseNI	ACTGG	5 cut(s)	140, 240, 610, 748, 1400
BseRI	GAGGAG	1 cut(s)	98
BseSI	GKGCMC	1 cut(s)	996
BseXI	GCAGC	7 cut(s)	146, 370, 599, 646, 668, 674, 940
BsgI	GTGCAG	2 cut(s)	345, 675
BshFI	GGCC	5 cut(s)	89, 201, 330, 444, 581
BshNI	GGYRCC	3 cut(s)	723, 993, 1313
BsiHKAI	GWGCWC	2 cut(s)	930, 1354
BsiSI	CCGG	2 cut(s)	68, 471
BslFI	GGGAC	2 cut(s)	1335, 1412
BslI	CCNNNNNNNGG	1 cut(s)	1453
BsmAI	GTCTC	6 cut(s)	44, 104, 204, 976, 1036, 1451
BsmFI	GGGAC	2 cut(s)	1335, 1412
BsmI	GAATGC	1 cut(s)	963
BsnI	GGCC	5 cut(s)	89, 201, 330, 444, 581
Bso31I	GGTCTC	1 cut(s)	204
Bsp1286I	GDGCHC	3 cut(s)	930, 996, 1354
Bsp143I	GATC	5 cut(s)	27, 393, 435, 567, 1053
Bsp19I	CCATGG	1 cut(s)	1317
BspACI	CCGC	1 cut(s)	1005
BspANI	GGCC	5 cut(s)	89, 201, 330, 444, 581
BspCNI	CTCAG	2 cut(s)	1028, 1474
BspHI	TCATGA	1 cut(s)	837
BspLI	GGNNCC	5 cut(s)	725, 892, 995, 1315, 1445
BspMAI	CTGCAG	1 cut(s)	664
BspMI	ACCTGC	1 cut(s)	1216
BspPI	GGATC	2 cut(s)	388, 1061
BspQI	GCTCTTC	1 cut(s)	1359
BspT107I	GGYRCC	3 cut(s)	723, 993, 1313
BspTNI	GGTCTC	1 cut(s)	204
BsrDI	GCAATG	1 cut(s)	594
BsrFI	RCCGGY	1 cut(s)	67
BsrI	ACTGG	5 cut(s)	140, 240, 610, 748, 1400
BssAI	RCCGGY	1 cut(s)	67
BssECI	CCNNGG	1 cut(s)	1317
BssMI	GATC	5 cut(s)	27, 393, 435, 567, 1053
BssT1I	CCWWGG	1 cut(s)	1317
Bst4CI	ACNGT	3 cut(s)	16, 115, 1115
Bst6I	CTCTTC	3 cut(s)	514, 626, 1359
BstAPI	GCANNNNNTGC	2 cut(s)	323, 881
BstC8I	GCNNGC	2 cut(s)	328, 1474
BstDEI	CTNAG	3 cut(s)	439, 1015, 1461
BstDSI	CCRYGG	1 cut(s)	1317
BstF5I	GGATG	3 cut(s)	582, 993, 1226
BstH2I	RGCGCY	1 cut(s)	364
BstHHI	GCGC	2 cut(s)	363, 1428
BstKTI	GATC	5 cut(s)	30, 396, 438, 570, 1056
BstMAI	GTCTC	6 cut(s)	44, 104, 204, 976, 1036, 1451
BstMBI	GATC	5 cut(s)	27, 393, 435, 567, 1053
BstMWI	GCNNNNNNNGC	9 cut(s)	143, 323, 467, 561, 587, 596, 662, 881, 1145
BstSFI	CTRYAG	1 cut(s)	660
BstSLI	GKGCMC	1 cut(s)	996
BstV1I	GCAGC	7 cut(s)	146, 370, 599, 646, 668, 674, 940
BstV2I	GAAGAC	3 cut(s)	63, 1096, 1265
BsuRI	GGCC	5 cut(s)	89, 201, 330, 444, 581
BtgI	CCRYGG	1 cut(s)	1317
BtsCI	GGATG	3 cut(s)	582, 993, 1226
BtsI	GCAGTG	1 cut(s)	882
BtsIMutI	CAGTG	5 cut(s)	120, 233, 882, 1023, 1120
BveI	ACCTGC	1 cut(s)	1216
Cac8I	GCNNGC	2 cut(s)	328, 1474
CciI	TCATGA	1 cut(s)	837
CfoI	GCGC	2 cut(s)	363, 1428
Cfr10I	RCCGGY	1 cut(s)	67
Csp6I	GTAC	3 cut(s)	17, 166, 1012
CspCI	CAANNNNNGTGG	2 cut(s)	175, 210
CviQI	GTAC	3 cut(s)	17, 166, 1012
DdeI	CTNAG	3 cut(s)	439, 1015, 1461
DpnI	GATC	5 cut(s)	29, 395, 437, 569, 1055
DpnII	GATC	5 cut(s)	27, 393, 435, 567, 1053
DraI	TTTAAA	1 cut(s)	1300
DraIII	CACNNNGTG	1 cut(s)	308
Eam1104I	CTCTTC	3 cut(s)	514, 626, 1359
EarI	CTCTTC	3 cut(s)	514, 626, 1359
Ecl136II	GAGCTC	1 cut(s)	928
Eco130I	CCWWGG	1 cut(s)	1317
Eco147I	AGGCCT	1 cut(s)	89
Eco24I	GRGCYC	1 cut(s)	930
Eco31I	GGTCTC	1 cut(s)	204
Eco47III	AGCGCT	1 cut(s)	362
Eco53kI	GAGCTC	1 cut(s)	928
Eco57I	CTGAAG	2 cut(s)	75, 527
EcoICRI	GAGCTC	1 cut(s)	928
EcoT14I	CCWWGG	1 cut(s)	1317
EcoT38I	GRGCYC	1 cut(s)	930
ErhI	CCWWGG	1 cut(s)	1317
FalI	AAGNNNNNCTT	2 cut(s)	779, 811
FaqI	GGGAC	2 cut(s)	1335, 1412
FauNDI	CATATG	1 cut(s)	319
FbaI	TGATCA	2 cut(s)	27, 567
Fnu4HI	GCNGC	7 cut(s)	135, 359, 588, 657, 660, 663, 954
FokI	GGATG	3 cut(s)	589, 1000, 1233
FriOI	GRGCYC	1 cut(s)	930
Fsp4HI	GCNGC	7 cut(s)	135, 359, 588, 657, 660, 663, 954
FspBI	CTAG	3 cut(s)	983, 1310, 1386
GlaI	GCGC	2 cut(s)	362, 1427
GluI	GCNGC	7 cut(s)	135, 359, 588, 657, 660, 663, 954
GsuI	CTGGAG	1 cut(s)	123
HaeII	RGCGCY	1 cut(s)	364
HaeIII	GGCC	5 cut(s)	89, 201, 330, 444, 581
HapII	CCGG	2 cut(s)	68, 471
HhaI	GCGC	2 cut(s)	363, 1428
Hin6I	GCGC	2 cut(s)	361, 1426
HinP1I	GCGC	2 cut(s)	361, 1426
HincII	GTYRAC	1 cut(s)	1197
HindII	GTYRAC	1 cut(s)	1197
HindIII	AAGCTT	1 cut(s)	788
HinfI	GANTC	4 cut(s)	172, 969, 1375, 1459
HpaI	GTTAAC	1 cut(s)	1197
HpaII	CCGG	2 cut(s)	68, 471
HphI	GGTGA	3 cut(s)	82, 175, 1240
Hpy166II	GTNNAC	4 cut(s)	341, 528, 847, 1197
Hpy188I	TCNGA	5 cut(s)	46, 209, 918, 1380, 1464
Hpy188III	TCNNGA	3 cut(s)	497, 838, 1386
Hpy8I	GTNNAC	4 cut(s)	341, 528, 847, 1197
HpyAV	CCTTC	5 cut(s)	551, 875, 904, 1163, 1298
HpyCH4III	ACNGT	3 cut(s)	16, 115, 1115
HpyCH4IV	ACGT	1 cut(s)	630
HpyF10VI	GCNNNNNNNGC	9 cut(s)	143, 323, 467, 561, 587, 596, 662, 881, 1145
HpyF3I	CTNAG	3 cut(s)	439, 1015, 1461
HpySE526I	ACGT	1 cut(s)	630
HspAI	GCGC	2 cut(s)	361, 1426
Ksp22I	TGATCA	2 cut(s)	27, 567
KspAI	GTTAAC	1 cut(s)	1197
Kzo9I	GATC	5 cut(s)	27, 393, 435, 567, 1053
LguI	GCTCTTC	1 cut(s)	1359
LmnI	GCTCC	3 cut(s)	142, 925, 1411
Lsp1109I	GCAGC	7 cut(s)	146, 370, 599, 646, 668, 674, 940
MaeI	CTAG	3 cut(s)	983, 1310, 1386
MaeII	ACGT	1 cut(s)	630
MaeIII	GTNAC	2 cut(s)	181, 1162
MalI	GATC	5 cut(s)	29, 395, 437, 569, 1055
MboI	GATC	5 cut(s)	27, 393, 435, 567, 1053
MfeI	CAATTG	2 cut(s)	288, 693
MhlI	GDGCHC	3 cut(s)	930, 996, 1354
MluCI	AATT	7 cut(s)	288, 520, 679, 687, 693, 919, 1246
MlyI	GAGTC	2 cut(s)	978, 1453
MmeI	TCCRAC	2 cut(s)	922, 1192
MnlI	CCTC	6 cut(s)	76, 79, 462, 724, 1208, 1399
MseI	TTAA	4 cut(s)	647, 765, 1196, 1299
MslI	CAYNNNNRTG	3 cut(s)	389, 575, 842
MspA1I	CMGCKG	1 cut(s)	659
MspI	CCGG	2 cut(s)	68, 471
MunI	CAATTG	2 cut(s)	288, 693
Mva1269I	GAATGC	1 cut(s)	963
MwoI	GCNNNNNNNGC	9 cut(s)	143, 323, 467, 561, 587, 596, 662, 881, 1145
NcoI	CCATGG	1 cut(s)	1317
NdeI	CATATG	1 cut(s)	319
NdeII	GATC	5 cut(s)	27, 393, 435, 567, 1053
NlaIV	GGNNCC	5 cut(s)	725, 892, 995, 1315, 1445
NmuCI	GTSAC	1 cut(s)	181
OliI	CACNNNNGTG	1 cut(s)	389
PagI	TCATGA	1 cut(s)	837
PaqCI	CACCTGC	1 cut(s)	1216
PceI	AGGCCT	1 cut(s)	89
PciSI	GCTCTTC	1 cut(s)	1359
PctI	GAATGC	1 cut(s)	963
PfeI	GAWTC	2 cut(s)	172, 1375
PkrI	GCNGC	7 cut(s)	136, 360, 589, 658, 661, 664, 955
PleI	GAGTC	2 cut(s)	977, 1453
PpsI	GAGTC	2 cut(s)	977, 1453
Psp124BI	GAGCTC	1 cut(s)	930
Psp1406I	AACGTT	1 cut(s)	630
PspN4I	GGNNCC	5 cut(s)	725, 892, 995, 1315, 1445
PsrI	GAACNNNNNNTAC	2 cut(s)	701, 733
PstI	CTGCAG	1 cut(s)	664
PvuII	CAGCTG	1 cut(s)	659
RsaI	GTAC	3 cut(s)	18, 167, 1013
RsaNI	GTAC	3 cut(s)	17, 166, 1012
RseI	CAYNNNNRTG	3 cut(s)	389, 575, 842
SacI	GAGCTC	1 cut(s)	930
SapI	GCTCTTC	1 cut(s)	1359
SaqAI	TTAA	4 cut(s)	647, 765, 1196, 1299
SatI	GCNGC	7 cut(s)	135, 359, 588, 657, 660, 663, 954
Sau3AI	GATC	5 cut(s)	27, 393, 435, 567, 1053
ScaI	AGTACT	2 cut(s)	167, 1013
SchI	GAGTC	2 cut(s)	978, 1453
SduI	GDGCHC	3 cut(s)	930, 996, 1354
SfcI	CTRYAG	1 cut(s)	660
SmiMI	CAYNNNNRTG	3 cut(s)	389, 575, 842
Sse9I	AATT	7 cut(s)	288, 520, 679, 687, 693, 919, 1246
SseBI	AGGCCT	1 cut(s)	89
SsiI	CCGC	1 cut(s)	1005
SspMI	CTAG	3 cut(s)	983, 1310, 1386
SstI	GAGCTC	1 cut(s)	930
StuI	AGGCCT	1 cut(s)	89
StyI	CCWWGG	1 cut(s)	1317
TaaI	ACNGT	3 cut(s)	16, 115, 1115
TaiI	ACGT	1 cut(s)	633
TaqI	TCGA	2 cut(s)	822, 967
TasI	AATT	7 cut(s)	288, 520, 679, 687, 693, 919, 1246
TatI	WGTACW	2 cut(s)	165, 1011
TfiI	GAWTC	2 cut(s)	172, 1375
Tru1I	TTAA	4 cut(s)	647, 765, 1196, 1299
Tru9I	TTAA	4 cut(s)	647, 765, 1196, 1299
TscAI	CASTG	5 cut(s)	120, 240, 882, 1023, 1120
TseFI	GTSAC	1 cut(s)	181
TseI	GCWGC	7 cut(s)	134, 358, 587, 656, 659, 662, 953
Tsp45I	GTSAC	1 cut(s)	181
TspDTI	ATGAA	7 cut(s)	390, 605, 613, 741, 799, 993, 1066
TspRI	CASTG	5 cut(s)	120, 240, 882, 1023, 1120
XapI	RAATTY	1 cut(s)	1246
XbaI	TCTAGA	1 cut(s)	1385
XspI	CTAG	3 cut(s)	983, 1310, 1386
ZrmI	AGTACT	2 cut(s)	167, 1013

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.