Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006187.1

Orthogroup ID

OG0001690

Physical Location & Seq

Genomic Coordinates Reverse (-)

11243 .. 12466

Gene Structure 1224 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006187.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 786 bp

atgtctgggttcaaaagccaaaggtggtcccttaagggtatgactgcactcgtcaccggtggaactagaggcattggatatgccattgtcgaagaactagcaggacttggggcaacagtgcatacctgtgctcgtaacaaggaaatgatcgatgagagggttcgagagtggaagattaagggatttaccgtgagtggttcagtttgtgacctcacatctaaatctcaaagggaggagctcataaagactgtctcatctgtttttgatggcaagcttagcatccttgtgaataatgctgcaatagtcacactcagaggagctaaagattatagtttagaagatttctcaagtatgatgagcagcaatgttgaatctccctaccatctttgtcaactagcacatcctcttctgaaggcatcaggaaatggaagcattatatttgtctcctctattgccggtataatagctctgcctaaactctccgcctatgcagcaaccaaaggagctatcatccagatttcaaagaatttggcatgtgaatgggcaaaagacaacattcgaacaaatactgtagcaccatgggcagtcaacactggggcagcagcagttgaaccggatgagcatcgtgatgatttcagaaggctaatagctcgaactcccattcgtcgccttgcagaccctaatgaaatttcatctctggtgacttttctttgcctcccagctgcttcttacatcaatggacaagttgttagcattgatggaggatttacagttggtggtttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00960 ko01100 ko01110 map00960 map01100 map01110

Pfam Domains

Protein Families

adh_short adh_short_C2

Protein Analysis

261

Amino Acids

28.03

Weight (kDa)

8.79

Isoelectric Point (pI)

29.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001690)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g13100 FvH4_6g13100 FvH4_6g13110 FvH4_6g13120 FvH4_6g21191
malus_domestica	MD04G1134900.v1.1 MD04G1135200.v1.1 MD04G1135300.v1.1 MD12G1148400.v1.1 MD12G1148500.v1.1 MD12G1148600.v1.1 MD12G1148800.v1.1 MD12G1149000.v1.1
pyrus_communis	pycom04g12230 pycom04g12240 pycom12g14270 pycom12g14280
rosa_chinensis	RchiOBHm_Chr3g0465411 RchiOBHm_Chr3g0465421 RchiOBHm_Chr3g0465491 RchiOBHm_Chr3g0477681
rosa_laevigata	RLG00000023701
rosa_multiflora	Rmu_sc0006187.1_g000004 Rmu_sc0011781.1_g000007 Rmu_sc0011781.1_g000008 Rmu_sc0011781.1_g000009
rosa_roxburghii	Rroxscaffold_6G00403760 Rroxscaffold_6G00415030 Rroxscaffold_6G00415050 Rroxscaffold_6G00415060
rosa_rugosa	Rorug03G0076400 Rorug03G0076500 Rorug03G0076600 Rorug03G0076700.1 Rorug03G0076800
rosa_samantha	Rh3AG212800 Rh3BG141700 Rh3BG141800 Rh3BG142100 Rh3BG246400 Rh3CG142800 Rh3CG142900 Rh3CG143400 Rh3CG240000 Rh3DG142800 Rh3DG142900 Rh3DG143200
rosa_wichuraiana	Rw3G011590 Rw3G019260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	483
AcsI	RAATTY	2 cut(s)	526, 687
AcuI	CTGAAG	1 cut(s)	431
AflII	CTTAAG	1 cut(s)	32
AgeI	ACCGGT	1 cut(s)	56
AgsI	TTSAA	4 cut(s)	13, 371, 522, 611
AluBI	AGCT	7 cut(s)	238, 274, 320, 467, 506, 650, 722
AluI	AGCT	7 cut(s)	238, 274, 320, 467, 506, 650, 722
Alw21I	GWGCWC	2 cut(s)	133, 240
Alw26I	GTCTC	2 cut(s)	256, 448
ApeKI	GCWGC	6 cut(s)	296, 360, 491, 599, 602, 722
ApoI	RAATTY	2 cut(s)	526, 687
AsiGI	ACCGGT	1 cut(s)	56
AspS9I	GGNCC	1 cut(s)	27
AsuHPI	GGTGA	2 cut(s)	46, 712
AsuII	TTCGAA	1 cut(s)	559
AvaII	GGWCC	1 cut(s)	27
BanII	GRGCYC	1 cut(s)	240
Bbv12I	GWGCWC	2 cut(s)	133, 240
BbvI	GCAGC	6 cut(s)	283, 372, 503, 611, 614, 709
BccI	CCATC	3 cut(s)	260, 390, 752
BcoDI	GTCTC	2 cut(s)	256, 448
BfaI	CTAG	4 cut(s)	66, 98, 395, 784
BfmI	CTRYAG	1 cut(s)	570
BfrI	CTTAAG	1 cut(s)	32
BisI	GCNGC	6 cut(s)	297, 361, 492, 600, 603, 723
BlpI	GCTNAGC	1 cut(s)	275
BlsI	GCNGC	6 cut(s)	298, 362, 493, 601, 604, 724
Bme18I	GGWCC	1 cut(s)	27
BmgT120I	GGNCC	1 cut(s)	27
BmiI	GGNNCC	1 cut(s)	29
BmrI	ACTGGG	1 cut(s)	603
BmsI	GCATC	3 cut(s)	288, 425, 631
BmuI	ACTGGG	1 cut(s)	603
Bpu1102I	GCTNAGC	1 cut(s)	275
Bpu14I	TTCGAA	1 cut(s)	559
BpuEI	CTTGAG	1 cut(s)	331
Bsa29I	ATCGAT	1 cut(s)	150
BsaBI	GATNNNNATC	1 cut(s)	621
BsaJI	CCNNGG	1 cut(s)	578
BsaWI	WCCGGW	2 cut(s)	56, 613
Bse118I	RCCGGY	2 cut(s)	56, 455
Bse1I	ACTGG	1 cut(s)	598
Bse3DI	GCAATG	1 cut(s)	370
Bse8I	GATNNNNATC	1 cut(s)	621
BseCI	ATCGAT	1 cut(s)	150
BseDI	CCNNGG	1 cut(s)	578
BseGI	GGATG	4 cut(s)	279, 400, 510, 622
BseJI	GATNNNNATC	1 cut(s)	621
BseMI	GCAATG	1 cut(s)	370
BseMII	CTCAG	1 cut(s)	325
BseNI	ACTGG	1 cut(s)	598
BseRI	GAGGAG	3 cut(s)	248, 330, 436
BseXI	GCAGC	6 cut(s)	283, 372, 503, 611, 614, 709
BseYI	CCCAGC	1 cut(s)	718
BsgI	GTGCAG	1 cut(s)	30
BshTI	ACCGGT	1 cut(s)	56
BshVI	ATCGAT	1 cut(s)	150
BsiHKAI	GWGCWC	2 cut(s)	133, 240
BsiSI	CCGG	3 cut(s)	57, 456, 614
BslFI	GGGAC	1 cut(s)	13
BsmAI	GTCTC	2 cut(s)	256, 448
BsmFI	GGGAC	1 cut(s)	13
Bsp119I	TTCGAA	1 cut(s)	559
Bsp1286I	GDGCHC	2 cut(s)	133, 240
Bsp143I	GATC	1 cut(s)	147
Bsp1720I	GCTNAGC	1 cut(s)	275
Bsp19I	CCATGG	1 cut(s)	578
BspACI	CCGC	1 cut(s)	483
BspCNI	CTCAG	1 cut(s)	324
BspDI	ATCGAT	1 cut(s)	150
BspLI	GGNNCC	1 cut(s)	29
BspT104I	TTCGAA	1 cut(s)	559
BspTI	CTTAAG	1 cut(s)	32
BsrDI	GCAATG	1 cut(s)	370
BsrFI	RCCGGY	2 cut(s)	56, 455
BsrI	ACTGG	1 cut(s)	598
BssAI	RCCGGY	2 cut(s)	56, 455
BssECI	CCNNGG	1 cut(s)	578
BssMI	GATC	1 cut(s)	147
BssT1I	CCWWGG	1 cut(s)	578
Bst4CI	ACNGT	5 cut(s)	118, 190, 250, 571, 772
Bst6I	CTCTTC	1 cut(s)	411
BstAFI	CTTAAG	1 cut(s)	32
BstBI	TTCGAA	1 cut(s)	559
BstC8I	GCNNGC	1 cut(s)	272
BstDEI	CTNAG	2 cut(s)	275, 311
BstDSI	CCRYGG	1 cut(s)	578
BstF5I	GGATG	4 cut(s)	279, 400, 510, 622
BstKTI	GATC	1 cut(s)	150
BstMAI	GTCTC	2 cut(s)	256, 448
BstMBI	GATC	1 cut(s)	147
BstMWI	GCNNNNNNNGC	3 cut(s)	276, 491, 581
BstNSI	RCATGY	1 cut(s)	537
BstSFI	CTRYAG	1 cut(s)	570
BstV1I	GCAGC	6 cut(s)	283, 372, 503, 611, 614, 709
Bsu15I	ATCGAT	1 cut(s)	150
BsuTUI	ATCGAT	1 cut(s)	150
BtgI	CCRYGG	1 cut(s)	578
BtsCI	GGATG	4 cut(s)	279, 400, 510, 622
BtsIMutI	CAGTG	2 cut(s)	123, 591
Cac8I	GCNNGC	1 cut(s)	272
Cfr10I	RCCGGY	2 cut(s)	56, 455
Cfr13I	GGNCC	1 cut(s)	27
ClaI	ATCGAT	1 cut(s)	150
CspAI	ACCGGT	1 cut(s)	56
CviAII	CATG	2 cut(s)	534, 579
CviJI	RGCY	9 cut(s)	18, 238, 274, 320, 467, 506, 643, 650, 722
CviKI_1	RGCY	9 cut(s)	18, 238, 274, 320, 467, 506, 643, 650, 722
DdeI	CTNAG	2 cut(s)	275, 311
DpnI	GATC	1 cut(s)	149
DpnII	GATC	1 cut(s)	147
Eam1104I	CTCTTC	1 cut(s)	411
EarI	CTCTTC	1 cut(s)	411
EciI	GGCGGA	1 cut(s)	472
Ecl136II	GAGCTC	1 cut(s)	238
Eco130I	CCWWGG	1 cut(s)	578
Eco24I	GRGCYC	1 cut(s)	240
Eco47I	GGWCC	1 cut(s)	27
Eco53kI	GAGCTC	1 cut(s)	238
Eco57I	CTGAAG	1 cut(s)	431
EcoICRI	GAGCTC	1 cut(s)	238
EcoT14I	CCWWGG	1 cut(s)	578
EcoT38I	GRGCYC	1 cut(s)	240
ErhI	CCWWGG	1 cut(s)	578
FaeI	CATG	2 cut(s)	537, 582
FaqI	GGGAC	1 cut(s)	13
FatI	CATG	2 cut(s)	533, 578
Fnu4HI	GCNGC	6 cut(s)	297, 361, 492, 600, 603, 723
FokI	GGATG	4 cut(s)	266, 387, 497, 629
FriOI	GRGCYC	1 cut(s)	240
Fsp4HI	GCNGC	6 cut(s)	297, 361, 492, 600, 603, 723
FspBI	CTAG	4 cut(s)	66, 98, 395, 784
GluI	GCNGC	6 cut(s)	297, 361, 492, 600, 603, 723
GsaI	CCCAGC	1 cut(s)	722
HapII	CCGG	3 cut(s)	57, 456, 614
Hin1II	CATG	2 cut(s)	537, 582
HincII	GTYRAC	2 cut(s)	392, 589
HindII	GTYRAC	2 cut(s)	392, 589
HindIII	AAGCTT	1 cut(s)	272
HinfI	GANTC	1 cut(s)	371
HpaII	CCGG	3 cut(s)	57, 456, 614
HphI	GGTGA	2 cut(s)	46, 712
Hpy166II	GTNNAC	2 cut(s)	392, 589
Hpy188I	TCNGA	3 cut(s)	314, 411, 638
Hpy188III	TCNNGA	4 cut(s)	164, 420, 514, 626
Hpy8I	GTNNAC	2 cut(s)	392, 589
Hpy99I	CGWCG	1 cut(s)	669
HpyAV	CCTTC	2 cut(s)	406, 633
HpyCH4III	ACNGT	5 cut(s)	118, 190, 250, 571, 772
HpyCH4V	TGCA	5 cut(s)	47, 121, 299, 491, 674
HpyF10VI	GCNNNNNNNGC	3 cut(s)	276, 491, 581
HpyF3I	CTNAG	2 cut(s)	275, 311
Hsp92II	CATG	2 cut(s)	537, 582
Kzo9I	GATC	1 cut(s)	147
LmnI	GCTCC	3 cut(s)	235, 317, 503
Lsp1109I	GCAGC	6 cut(s)	283, 372, 503, 611, 614, 709
LweI	GCATC	3 cut(s)	288, 425, 631
MaeI	CTAG	4 cut(s)	66, 98, 395, 784
MaeIII	GTNAC	5 cut(s)	52, 134, 206, 304, 700
MalI	GATC	1 cut(s)	149
MboI	GATC	1 cut(s)	147
MboII	GAAGA	4 cut(s)	104, 184, 350, 398
MhlI	GDGCHC	2 cut(s)	133, 240
MluCI	AATT	2 cut(s)	526, 687
MnlI	CCTC	9 cut(s)	62, 150, 221, 226, 308, 414, 457, 725, 755
MseI	TTAA	2 cut(s)	33, 177
MslI	CAYNNNNRTG	4 cut(s)	126, 284, 538, 627
MspA1I	CMGCKG	1 cut(s)	722
MspCI	CTTAAG	1 cut(s)	32
MspI	CCGG	3 cut(s)	57, 456, 614
MwoI	GCNNNNNNNGC	3 cut(s)	276, 491, 581
NcoI	CCATGG	1 cut(s)	578
NdeII	GATC	1 cut(s)	147
NlaIII	CATG	2 cut(s)	537, 582
NlaIV	GGNNCC	1 cut(s)	29
NmuCI	GTSAC	4 cut(s)	52, 206, 304, 700
NspI	RCATGY	1 cut(s)	537
NspV	TTCGAA	1 cut(s)	559
PfeI	GAWTC	1 cut(s)	371
PinAI	ACCGGT	1 cut(s)	56
PkrI	GCNGC	6 cut(s)	298, 362, 493, 601, 604, 724
Psp124BI	GAGCTC	1 cut(s)	240
PspFI	CCCAGC	1 cut(s)	718
PspN4I	GGNNCC	1 cut(s)	29
PspPI	GGNCC	1 cut(s)	27
PvuII	CAGCTG	1 cut(s)	722
RseI	CAYNNNNRTG	4 cut(s)	126, 284, 538, 627
SacI	GAGCTC	1 cut(s)	240
SaqAI	TTAA	2 cut(s)	33, 177
SatI	GCNGC	6 cut(s)	297, 361, 492, 600, 603, 723
Sau3AI	GATC	1 cut(s)	147
Sau96I	GGNCC	1 cut(s)	27
SduI	GDGCHC	2 cut(s)	133, 240
SfaNI	GCATC	3 cut(s)	288, 425, 631
SfcI	CTRYAG	1 cut(s)	570
SfuI	TTCGAA	1 cut(s)	559
SgrAI	CRCCGGYG	1 cut(s)	56
SinI	GGWCC	1 cut(s)	27
SmiMI	CAYNNNNRTG	4 cut(s)	126, 284, 538, 627
SmlI	CTYRAG	2 cut(s)	32, 346
SmoI	CTYRAG	2 cut(s)	32, 346
Sse9I	AATT	2 cut(s)	526, 687
SsiI	CCGC	1 cut(s)	483
SspMI	CTAG	4 cut(s)	66, 98, 395, 784
SstI	GAGCTC	1 cut(s)	240
StyI	CCWWGG	1 cut(s)	578
TaaI	ACNGT	5 cut(s)	118, 190, 250, 571, 772
TaqI	TCGA	5 cut(s)	90, 150, 163, 559, 652
TasI	AATT	2 cut(s)	526, 687
TfiI	GAWTC	1 cut(s)	371
Tru1I	TTAA	2 cut(s)	33, 177
Tru9I	TTAA	2 cut(s)	33, 177
TscAI	CASTG	2 cut(s)	123, 598
TseFI	GTSAC	4 cut(s)	52, 206, 304, 700
TseI	GCWGC	6 cut(s)	296, 360, 491, 599, 602, 722
Tsp45I	GTSAC	4 cut(s)	52, 206, 304, 700
TspDTI	ATGAA	2 cut(s)	681, 699
TspRI	CASTG	2 cut(s)	123, 598
Vha464I	CTTAAG	1 cut(s)	32
VpaK11BI	GGWCC	1 cut(s)	27
XapI	RAATTY	2 cut(s)	526, 687
XceI	RCATGY	1 cut(s)	537
XspI	CTAG	4 cut(s)	66, 98, 395, 784

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.