Rorug03G0076800

Tropinone reductase homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
OG0001690
Physical Location & Seq
Reverse (-)
5995875 .. 5996218
344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0076800.1

Sequence Viewer

Length: 222 bp
ATGAAAGATATCATTAAGCCAGAGGGTTGGGACGCACCATGGAACAATGGTCGATATGAATTGACTGCGTTCTCGGAGGAGGATTGTAAAGGGCCTGGGGCAGACTTGTCCGATCGTGTACCATGGGAGAAGAAGCAGCTATCAGCTGAGGAACTGTCTTATTTCAGTAATACAGCTTCTTTCATAAACCAAGATGGATGGTTGGAAAAACAACCCAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00960 ko01100 ko01110 map00960 map01100 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

73

Amino Acids

8.39

Weight (kDa)

4.56

Isoelectric Point (pI)

36.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pectinesterase PF01095 1 - 63 5e-06 Pectinesterase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 120
AjnI CCWGG 1 cut(s) 94
AluBI AGCT 3 cut(s) 139, 146, 176
AluI AGCT 3 cut(s) 139, 146, 176
AoxI GGCC 1 cut(s) 92
ApeKI GCWGC 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 92
BarI GAAGNNNNNNTAC 2 cut(s) 160, 192
BbvCI CCTCAGC 1 cut(s) 147
BbvI GCAGC 1 cut(s) 148
BccI CCATC 2 cut(s) 188, 192
BciT130I CCWGG 1 cut(s) 96
BisI GCNGC 1 cut(s) 137
BlsI GCNGC 1 cut(s) 138
Bme1390I CCNGG 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 92
BmrFI CCNGG 1 cut(s) 96
Bpu10I CCTNAGC 1 cut(s) 147
BsaJI CCNNGG 3 cut(s) 38, 95, 122
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 3 cut(s) 38, 95, 122
BseGI GGATG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 138
BseRI GAGGAG 1 cut(s) 92
BseXI GCAGC 1 cut(s) 148
Bsh1285I CGRYCG 1 cut(s) 115
BshFI GGCC 1 cut(s) 94
BsiEI CGRYCG 1 cut(s) 115
BslFI GGGAC 1 cut(s) 44
BsmFI GGGAC 1 cut(s) 44
BsnI GGCC 1 cut(s) 94
Bsp143I GATC 1 cut(s) 112
Bsp19I CCATGG 2 cut(s) 38, 122
BspANI GGCC 1 cut(s) 94
BspCNI CTCAG 1 cut(s) 139
BssECI CCNNGG 3 cut(s) 38, 95, 122
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 2 cut(s) 38, 122
Bst2UI CCWGG 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 147
BstDSI CCRYGG 2 cut(s) 38, 122
BstF5I GGATG 1 cut(s) 203
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMCI CGRYCG 1 cut(s) 115
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 148
BstXI CCANNNNNNTGG 1 cut(s) 27
BsuRI GGCC 1 cut(s) 94
BtgI CCRYGG 2 cut(s) 38, 122
BtsCI GGATG 1 cut(s) 203
Cfr13I GGNCC 1 cut(s) 92
CseI GACGC 1 cut(s) 41
Csp6I GTAC 1 cut(s) 119
CviAII CATG 2 cut(s) 39, 123
CviJI RGCY 5 cut(s) 19, 94, 139, 146, 176
CviKI_1 RGCY 5 cut(s) 19, 94, 139, 146, 176
CviQI GTAC 1 cut(s) 119
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco130I CCWWGG 2 cut(s) 38, 122
Eco32I GATATC 1 cut(s) 10
EcoO109I RGGNCCY 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 94
EcoRV GATATC 1 cut(s) 10
EcoT14I CCWWGG 2 cut(s) 38, 122
ErhI CCWWGG 2 cut(s) 38, 122
FaeI CATG 2 cut(s) 42, 126
FaiI YATR 4 cut(s) 40, 57, 124, 185
FaqI GGGAC 1 cut(s) 44
FatI CATG 2 cut(s) 38, 122
Fnu4HI GCNGC 1 cut(s) 137
FokI GGATG 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 137
GluI GCNGC 1 cut(s) 137
HaeIII GGCC 1 cut(s) 94
HgaI GACGC 1 cut(s) 41
Hin1II CATG 2 cut(s) 42, 126
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 2 cut(s) 76, 112
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 156
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 2 cut(s) 42, 126
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 33, 81, 108
Lsp1109I GCAGC 1 cut(s) 148
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 1 cut(s) 142
MluCI AATT 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 183
MnlI CCTC 4 cut(s) 16, 70, 73, 142
MseI TTAA 1 cut(s) 15
MspA1I CMGCKG 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
NcoI CCATGG 2 cut(s) 38, 122
NdeII GATC 1 cut(s) 112
NlaIII CATG 2 cut(s) 42, 126
PkrI GCNGC 1 cut(s) 138
Ple19I CGATCG 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspPI GGNCC 1 cut(s) 92
PvuI CGATCG 1 cut(s) 115
PvuII CAGCTG 1 cut(s) 146
RsaI GTAC 1 cut(s) 120
RsaNI GTAC 1 cut(s) 119
SaqAI TTAA 1 cut(s) 15
SatI GCNGC 1 cut(s) 137
Sau3AI GATC 1 cut(s) 112
Sau96I GGNCC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 96
SetI ASST 3 cut(s) 141, 148, 178
SgeI CNNG 9 cut(s) 32, 51, 85, 107, 108, 118, 128, 135, 203
Sse9I AATT 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 94
StyI CCWWGG 2 cut(s) 38, 122
TaaI ACNGT 1 cut(s) 156
TaqI TCGA 1 cut(s) 52
TasI AATT 1 cut(s) 59
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TseI GCWGC 1 cut(s) 136
TspDTI ATGAA 3 cut(s) 17, 72, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.