Rmu_sc0007029.1_g000029

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007029.1
OG0003779
Physical Location & Seq
Reverse (-)
128331 .. 128606
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007029.1_g000029.1.cds

Sequence Viewer

Length: 276 bp
atgcgcgcactgactatgtgtctttgttttactgatgcagttcgtgaaaatggagtggtggtgtgtaaagatgacgatgatgatgaggatccctacaaaggggatcctaatataggggagcctttcaggtgcctaacatcgtgggactgtacaactaatgaaacttgcaagcgagactgctcccagaaatttccccaaggtcgtggtttctgcatgtccgagccccctttcaaggcttgcttgtgctcctacaattgcccccctccacccccctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.21

Weight (kDa)

4.51

Isoelectric Point (pI)

64.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 129
AccII CGCG 1 cut(s) 6
AclWI GGATC 4 cut(s) 83, 96, 98, 111
AcsI RAATTY 1 cut(s) 188
AfaI GTAC 1 cut(s) 151
AfiI CCNNNNNNNGG 4 cut(s) 98, 99, 113, 232
AgsI TTSAA 1 cut(s) 232
AhdI GACNNNNNGTC 1 cut(s) 18
Alw21I GWGCWC 1 cut(s) 248
Alw26I GTCTC 1 cut(s) 168
AlwI GGATC 4 cut(s) 83, 96, 98, 111
ApoI RAATTY 1 cut(s) 188
AspLEI GCGC 2 cut(s) 6, 8
BamHI GGATCC 2 cut(s) 88, 103
BanI GGYRCC 1 cut(s) 129
BanII GRGCYC 1 cut(s) 225
Bbv12I GWGCWC 1 cut(s) 248
BcoDI GTCTC 1 cut(s) 168
BfaI CTAG 1 cut(s) 274
BmeRI GACNNNNNGTC 1 cut(s) 18
BmiI GGNNCC 4 cut(s) 90, 105, 120, 131
BmsI GCATC 1 cut(s) 25
BsaBI GATNNNNATC 1 cut(s) 87
BsaJI CCNNGG 1 cut(s) 196
BsaXI ACNNNNNCTCC 2 cut(s) 45, 75
Bsc4I CCNNNNNNNGG 4 cut(s) 98, 99, 113, 232
Bse8I GATNNNNATC 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 196
BseJI GATNNNNATC 1 cut(s) 87
BseLI CCNNNNNNNGG 4 cut(s) 98, 99, 113, 232
BsePI GCGCGC 1 cut(s) 4
Bsh1236I CGCG 1 cut(s) 6
BshNI GGYRCC 1 cut(s) 129
BsiHKAI GWGCWC 1 cut(s) 248
BslFI GGGAC 1 cut(s) 158
BslI CCNNNNNNNGG 4 cut(s) 98, 99, 113, 232
BsmAI GTCTC 1 cut(s) 168
BsmFI GGGAC 1 cut(s) 158
Bsp1286I GDGCHC 2 cut(s) 225, 248
Bsp1407I TGTACA 1 cut(s) 149
Bsp143I GATC 2 cut(s) 88, 103
BspFNI CGCG 1 cut(s) 6
BspLI GGNNCC 4 cut(s) 90, 105, 120, 131
BspPI GGATC 4 cut(s) 83, 96, 98, 111
BspT107I GGYRCC 1 cut(s) 129
BsrGI TGTACA 1 cut(s) 149
BssECI CCNNGG 1 cut(s) 196
BssHII GCGCGC 1 cut(s) 4
BssMI GATC 2 cut(s) 88, 103
BssT1I CCWWGG 1 cut(s) 196
Bst4CI ACNGT 1 cut(s) 149
BstAUI TGTACA 1 cut(s) 149
BstC8I GCNNGC 3 cut(s) 6, 170, 238
BstENI CCTNNNNNAGG 1 cut(s) 111
BstFNI CGCG 1 cut(s) 6
BstHHI GCGC 2 cut(s) 6, 8
BstKTI GATC 2 cut(s) 91, 106
BstMAI GTCTC 1 cut(s) 168
BstMBI GATC 2 cut(s) 88, 103
BstNSI RCATGY 1 cut(s) 217
BstUI CGCG 1 cut(s) 6
BstX2I RGATCY 2 cut(s) 88, 103
BstXI CCANNNNNNTGG 1 cut(s) 203
BstYI RGATCY 2 cut(s) 88, 103
BtsIMutI CAGTG 1 cut(s) 8
Cac8I GCNNGC 3 cut(s) 6, 170, 238
CfoI GCGC 2 cut(s) 6, 8
Csp6I GTAC 1 cut(s) 150
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 121, 223, 236
CviKI_1 RGCY 3 cut(s) 121, 223, 236
CviQI GTAC 1 cut(s) 150
DpnI GATC 2 cut(s) 90, 105
DpnII GATC 2 cut(s) 88, 103
DriI GACNNNNNGTC 1 cut(s) 18
Eam1105I GACNNNNNGTC 1 cut(s) 18
Eco130I CCWWGG 1 cut(s) 196
Eco24I GRGCYC 1 cut(s) 225
EcoNI CCTNNNNNAGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 196
EcoT38I GRGCYC 1 cut(s) 225
ErhI CCWWGG 1 cut(s) 196
FaeI CATG 1 cut(s) 217
FaiI YATR 3 cut(s) 17, 113, 215
FalI AAGNNNNNCTT 2 cut(s) 224, 256
FaqI GGGAC 1 cut(s) 158
FatI CATG 1 cut(s) 213
FriOI GRGCYC 1 cut(s) 225
FspBI CTAG 1 cut(s) 274
GlaI GCGC 2 cut(s) 5, 7
HhaI GCGC 2 cut(s) 6, 8
Hin1II CATG 1 cut(s) 217
Hin6I GCGC 2 cut(s) 4, 6
HinP1I GCGC 2 cut(s) 4, 6
Hpy188I TCNGA 1 cut(s) 220
Hpy188III TCNNGA 1 cut(s) 44
HpyCH4III ACNGT 1 cut(s) 149
HpyCH4V TGCA 3 cut(s) 38, 168, 213
Hsp92II CATG 1 cut(s) 217
HspAI GCGC 2 cut(s) 4, 6
Kzo9I GATC 2 cut(s) 88, 103
LmnI GCTCC 3 cut(s) 118, 185, 251
LpnPI CCDG 2 cut(s) 112, 197
LweI GCATC 1 cut(s) 25
MaeI CTAG 1 cut(s) 274
MalI GATC 2 cut(s) 90, 105
MboI GATC 2 cut(s) 88, 103
MfeI CAATTG 1 cut(s) 253
MflI RGATCY 2 cut(s) 88, 103
MhlI GDGCHC 2 cut(s) 225, 248
MluCI AATT 2 cut(s) 188, 253
MnlI CCTC 2 cut(s) 79, 273
MunI CAATTG 1 cut(s) 253
MvnI CGCG 1 cut(s) 6
NdeII GATC 2 cut(s) 88, 103
NlaIII CATG 1 cut(s) 217
NlaIV GGNNCC 4 cut(s) 90, 105, 120, 131
NspI RCATGY 1 cut(s) 217
PauI GCGCGC 1 cut(s) 4
PspN4I GGNNCC 4 cut(s) 90, 105, 120, 131
PsuI RGATCY 2 cut(s) 88, 103
PteI GCGCGC 1 cut(s) 4
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
Sau3AI GATC 2 cut(s) 88, 103
SduI GDGCHC 2 cut(s) 225, 248
SetI ASST 2 cut(s) 131, 202
SfaNI GCATC 1 cut(s) 25
Sse9I AATT 2 cut(s) 188, 253
SspMI CTAG 1 cut(s) 274
StyI CCWWGG 1 cut(s) 196
TaaI ACNGT 1 cut(s) 149
TasI AATT 2 cut(s) 188, 253
TatI WGTACW 1 cut(s) 149
TscAI CASTG 1 cut(s) 15
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 1 cut(s) 15
XagI CCTNNNNNAGG 1 cut(s) 111
XapI RAATTY 1 cut(s) 188
XceI RCATGY 1 cut(s) 217
XspI CTAG 1 cut(s) 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.