Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0003779

Physical Location & Seq

Genomic Coordinates Forward (+)

25703618 .. 25704255

Gene Structure 638 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00186350.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

ATGGCCATCATATCTTTCACTCAGCTTGCTCTACTCGCTTTTGCATTAGTTGCAATTATGAGGATGTTTGTGAAGGCAGATACATGCTTCAAATCAGTGGGTTCTTGCGACAACCTTGACTGCAACATAGTCTGTAGGAGTAATCATCTTGGTGGTGTCGGAAAATGTAATGAAACAAATACTTGCAATTGCTATTACTCTTGTCCTGGAAAGTCAAACTCATCACCGGCAGTAGTAACTCCAAATGATAAATTCTGCACAGCTGCCCAAGGAAAATGTGATGCTGAGTGTGATGAACAGTGTTGCATTCACAGCTGTGCAGTTATATATAAAGGTGGTGTTGGACATTGTGATGATCAACCCCGTGGTGGATTTAAAATATGTAATTGTGACTATCCTTGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF707

Protein Analysis

134

Amino Acids

14.32

Weight (kDa)

6.24

Isoelectric Point (pI)

36.78

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003779)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G30070 AT4G30074 AT5G38317 AT5G38330 AT5G42242
fragaria_vesca	FvH4_2g17511 FvH4_2g17531 FvH4_2g20970 FvH4_4g06580
malus_domestica	MD12G1050000.v1.1
prunus_persica	Prupe.1G068300_v2.0.a1 Prupe.1G078000_v2.0.a1 Prupe.1G079900_v2.0.a1 Prupe.1G080000_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0287351
rosa_laevigata	RLG00000012496
rosa_multiflora	Rmu_sc0007029.1_g000029
rosa_roxburghii	Rroxscaffold_159G00433110 Rroxscaffold_175G00431890 Rroxscaffold_4G00325080 Rroxscaffold_5G00343450 Rroxscaffold_5G00345150 Rroxscaffold_6G00398330 Rroxscaffold_7G00181510 Rroxscaffold_7G00186350
rosa_rugosa	Rorug04G0008400 Rorug06G0187300
rosa_samantha	Rh4DG078100 Rh4DG092300 Rh6AG298700 Rh6CG305400 Rh6CG312800 Rh6DG296100
rosa_wichuraiana	Rw0G022670

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	3
AcsI	RAATTY	1 cut(s)	251
AfiI	CCNNNNNNNGG	1 cut(s)	368
AgsI	TTSAA	1 cut(s)	91
AjnI	CCWGG	1 cut(s)	205
AleI	CACNNNNGTG	1 cut(s)	315
AluBI	AGCT	3 cut(s)	25, 263, 315
AluI	AGCT	3 cut(s)	25, 263, 315
AoxI	GGCC	1 cut(s)	3
ApeKI	GCWGC	1 cut(s)	263
ApoI	RAATTY	1 cut(s)	251
AsuHPI	GGTGA	1 cut(s)	216
BalI	TGGCCA	1 cut(s)	5
BbvI	GCAGC	1 cut(s)	250
BccI	CCATC	1 cut(s)	14
BciT130I	CCWGG	1 cut(s)	207
BclI	TGATCA	1 cut(s)	355
BfaI	CTAG	1 cut(s)	403
BfmI	CTRYAG	1 cut(s)	133
BisI	GCNGC	1 cut(s)	264
BlsI	GCNGC	1 cut(s)	265
Bme1390I	CCNGG	1 cut(s)	207
BmrFI	CCNGG	1 cut(s)	207
BmsI	GCATC	1 cut(s)	271
BsaJI	CCNNGG	2 cut(s)	268, 364
Bsc4I	CCNNNNNNNGG	1 cut(s)	368
Bse118I	RCCGGY	1 cut(s)	226
BseBI	CCWGG	1 cut(s)	207
BseDI	CCNNGG	2 cut(s)	268, 364
BseGI	GGATG	1 cut(s)	69
BseLI	CCNNNNNNNGG	1 cut(s)	368
BseMII	CTCAG	2 cut(s)	35, 276
BseXI	GCAGC	1 cut(s)	250
BsgI	GTGCAG	2 cut(s)	241, 339
BshFI	GGCC	1 cut(s)	5
BsiSI	CCGG	1 cut(s)	227
BslI	CCNNNNNNNGG	1 cut(s)	368
BsmI	GAATGC	1 cut(s)	306
BsnI	GGCC	1 cut(s)	5
Bsp143I	GATC	1 cut(s)	355
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	2 cut(s)	34, 277
BsrFI	RCCGGY	1 cut(s)	226
BssAI	RCCGGY	1 cut(s)	226
BssECI	CCNNGG	2 cut(s)	268, 364
BssMI	GATC	1 cut(s)	355
BssT1I	CCWWGG	1 cut(s)	268
Bst2UI	CCWGG	1 cut(s)	207
Bst4CI	ACNGT	1 cut(s)	300
BstAPI	GCANNNNNTGC	1 cut(s)	50
BstC8I	GCNNGC	1 cut(s)	27
BstDEI	CTNAG	2 cut(s)	21, 285
BstDSI	CCRYGG	1 cut(s)	364
BstF5I	GGATG	1 cut(s)	69
BstKTI	GATC	1 cut(s)	358
BstMBI	GATC	1 cut(s)	355
BstMWI	GCNNNNNNNGC	3 cut(s)	35, 50, 312
BstNI	CCWGG	1 cut(s)	207
BstNSI	RCATGY	1 cut(s)	87
BstSCI	CCNGG	1 cut(s)	205
BstSFI	CTRYAG	1 cut(s)	133
BstV1I	GCAGC	1 cut(s)	250
BsuRI	GGCC	1 cut(s)	5
BtgI	CCRYGG	1 cut(s)	364
BtsCI	GGATG	1 cut(s)	69
BtsIMutI	CAGTG	2 cut(s)	102, 305
Cac8I	GCNNGC	1 cut(s)	27
Cfr10I	RCCGGY	1 cut(s)	226
CviAII	CATG	1 cut(s)	84
CviJI	RGCY	4 cut(s)	5, 25, 263, 315
CviKI_1	RGCY	4 cut(s)	5, 25, 263, 315
DdeI	CTNAG	2 cut(s)	21, 285
DpnI	GATC	1 cut(s)	357
DpnII	GATC	1 cut(s)	355
DraI	TTTAAA	1 cut(s)	376
EaeI	YGGCCR	1 cut(s)	3
Eco130I	CCWWGG	1 cut(s)	268
EcoRII	CCWGG	1 cut(s)	205
EcoT14I	CCWWGG	1 cut(s)	268
ErhI	CCWWGG	1 cut(s)	268
FaeI	CATG	1 cut(s)	87
FaiI	YATR	8 cut(s)	11, 59, 85, 128, 326, 328, 330, 382
FatI	CATG	1 cut(s)	83
FbaI	TGATCA	1 cut(s)	355
Fnu4HI	GCNGC	1 cut(s)	264
FokI	GGATG	1 cut(s)	76
Fsp4HI	GCNGC	1 cut(s)	264
FspBI	CTAG	1 cut(s)	403
GluI	GCNGC	1 cut(s)	264
HaeIII	GGCC	1 cut(s)	5
HapII	CCGG	1 cut(s)	227
Hin1II	CATG	1 cut(s)	87
HpaII	CCGG	1 cut(s)	227
HphI	GGTGA	1 cut(s)	216
Hpy188I	TCNGA	1 cut(s)	161
HpyAV	CCTTC	1 cut(s)	67
HpyCH4III	ACNGT	1 cut(s)	300
HpyCH4V	TGCA	7 cut(s)	44, 53, 123, 186, 258, 306, 320
HpyF10VI	GCNNNNNNNGC	3 cut(s)	35, 50, 312
HpyF3I	CTNAG	2 cut(s)	21, 285
Hsp92II	CATG	1 cut(s)	87
Ksp22I	TGATCA	1 cut(s)	355
Kzo9I	GATC	1 cut(s)	355
LpnPI	CCDG	3 cut(s)	192, 219, 240
Lsp1109I	GCAGC	1 cut(s)	250
LweI	GCATC	1 cut(s)	271
MaeI	CTAG	1 cut(s)	403
MaeIII	GTNAC	2 cut(s)	235, 389
MalI	GATC	1 cut(s)	357
MboI	GATC	1 cut(s)	355
MfeI	CAATTG	1 cut(s)	187
MlsI	TGGCCA	1 cut(s)	5
MluCI	AATT	4 cut(s)	54, 187, 251, 385
MluNI	TGGCCA	1 cut(s)	5
MmeI	TCCRAC	2 cut(s)	139, 322
MnlI	CCTC	1 cut(s)	54
Mox20I	TGGCCA	1 cut(s)	5
MscI	TGGCCA	1 cut(s)	5
MseI	TTAA	1 cut(s)	375
MslI	CAYNNNNRTG	3 cut(s)	150, 315, 351
Msp20I	TGGCCA	1 cut(s)	5
MspA1I	CMGCKG	2 cut(s)	263, 315
MspI	CCGG	1 cut(s)	227
MspR9I	CCNGG	1 cut(s)	207
MunI	CAATTG	1 cut(s)	187
Mva1269I	GAATGC	1 cut(s)	306
MvaI	CCWGG	1 cut(s)	207
MwoI	GCNNNNNNNGC	3 cut(s)	35, 50, 312
NdeII	GATC	1 cut(s)	355
NlaIII	CATG	1 cut(s)	87
NmuCI	GTSAC	1 cut(s)	389
NspI	RCATGY	1 cut(s)	87
OliI	CACNNNNGTG	1 cut(s)	315
PctI	GAATGC	1 cut(s)	306
PfoI	TCCNGGA	1 cut(s)	205
PkrI	GCNGC	1 cut(s)	265
Psp6I	CCWGG	1 cut(s)	205
PspGI	CCWGG	1 cut(s)	205
PvuII	CAGCTG	2 cut(s)	263, 315
RseI	CAYNNNNRTG	3 cut(s)	150, 315, 351
SaqAI	TTAA	1 cut(s)	375
SatI	GCNGC	1 cut(s)	264
Sau3AI	GATC	1 cut(s)	355
ScrFI	CCNGG	1 cut(s)	207
SetI	ASST	5 cut(s)	27, 117, 265, 317, 337
SfaNI	GCATC	1 cut(s)	271
SfcI	CTRYAG	1 cut(s)	133
SmiMI	CAYNNNNRTG	3 cut(s)	150, 315, 351
Sse9I	AATT	4 cut(s)	54, 187, 251, 385
SspMI	CTAG	1 cut(s)	403
StyD4I	CCNGG	1 cut(s)	205
StyI	CCWWGG	1 cut(s)	268
TaaI	ACNGT	1 cut(s)	300
TasI	AATT	4 cut(s)	54, 187, 251, 385
Tru1I	TTAA	1 cut(s)	375
Tru9I	TTAA	1 cut(s)	375
TscAI	CASTG	2 cut(s)	102, 305
TseFI	GTSAC	1 cut(s)	389
TseI	GCWGC	1 cut(s)	263
Tsp45I	GTSAC	1 cut(s)	389
TspDTI	ATGAA	2 cut(s)	186, 309
TspRI	CASTG	2 cut(s)	102, 305
XapI	RAATTY	1 cut(s)	251
XceI	RCATGY	1 cut(s)	87
XspI	CTAG	1 cut(s)	403

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.