Rmu_sc0008947.1_g000011

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008947.1
OG0001727
Physical Location & Seq
Reverse (-)
56753 .. 57112
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008947.1_g000011.1.cds

Sequence Viewer

Length: 360 bp
atgaaaagaaaaggtaaaaggcaagagctcgctgtgcatcccaattttgtgaaggtatccataagcttcactcaggtccagtctctggatgagctggttaagcagttgagtaaagacattgataagctgaaactgtatgggaagaatggaaaactggaatgtggggttgaagagtatgtgcctagaatgcttgaattcgacgtgaataacagggagcctgagctgaattgtatgtgggatttgggttgggatgtgaccatgtttgggtttgttgaagtggatgaagttgtgagggatttggagaggggtgtgctcagtggacttgttgatgagcttaccagagacctctttcatatgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VARLMGL

Protein Analysis

119

Amino Acids

13.86

Weight (kDa)

5.07

Isoelectric Point (pI)

23.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AcsI RAATTY 1 cut(s) 194
AfiI CCNNNNNNNGG 2 cut(s) 85, 264
AgsI TTSAA 3 cut(s) 170, 194, 275
AjiI CACGTC 1 cut(s) 202
AluBI AGCT 6 cut(s) 28, 66, 94, 127, 223, 334
AluI AGCT 6 cut(s) 28, 66, 94, 127, 223, 334
Alw21I GWGCWC 2 cut(s) 30, 315
Alw26I GTCTC 2 cut(s) 87, 336
AlwNI CAGNNNCTG 1 cut(s) 85
ApoI RAATTY 1 cut(s) 194
AspS9I GGNCC 1 cut(s) 76
AvaII GGWCC 1 cut(s) 76
BanII GRGCYC 1 cut(s) 30
Bbv12I GWGCWC 2 cut(s) 30, 315
BciVI GTATCC 1 cut(s) 67
BcoDI GTCTC 2 cut(s) 87, 336
BfaI CTAG 1 cut(s) 183
BfuI GTATCC 1 cut(s) 67
Bme18I GGWCC 1 cut(s) 76
BmgBI CACGTC 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 76
BmiI GGNNCC 1 cut(s) 216
BmsI GCATC 1 cut(s) 46
Bpu10I CCTNAGC 1 cut(s) 219
BsaI GGTCTC 1 cut(s) 336
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 264
Bse1I ACTGG 2 cut(s) 79, 159
BseGI GGATG 4 cut(s) 37, 94, 256, 286
BseLI CCNNNNNNNGG 2 cut(s) 85, 264
BseMII CTCAG 3 cut(s) 86, 210, 328
BseNI ACTGG 2 cut(s) 79, 159
BsiHKAI GWGCWC 2 cut(s) 30, 315
BslI CCNNNNNNNGG 2 cut(s) 85, 264
BsmAI GTCTC 2 cut(s) 87, 336
BsmI GAATGC 1 cut(s) 192
Bso31I GGTCTC 1 cut(s) 336
Bsp1286I GDGCHC 2 cut(s) 30, 315
BspCNI CTCAG 3 cut(s) 85, 211, 327
BspLI GGNNCC 1 cut(s) 216
BspTNI GGTCTC 1 cut(s) 336
BsrI ACTGG 2 cut(s) 79, 159
Bst4CI ACNGT 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 165
BstC8I GCNNGC 1 cut(s) 30
BstDEI CTNAG 3 cut(s) 72, 219, 314
BstF5I GGATG 4 cut(s) 37, 94, 256, 286
BstMAI GTCTC 2 cut(s) 87, 336
BstMWI GCNNNNNNNGC 3 cut(s) 34, 100, 187
BsuI GTATCC 1 cut(s) 67
BtrI CACGTC 1 cut(s) 202
BtsCI GGATG 4 cut(s) 37, 94, 256, 286
BtsIMutI CAGTG 1 cut(s) 322
Cac8I GCNNGC 1 cut(s) 30
CaiI CAGNNNCTG 1 cut(s) 85
Cfr13I GGNCC 1 cut(s) 76
CviAII CATG 1 cut(s) 259
CviJI RGCY 7 cut(s) 28, 66, 94, 127, 217, 223, 334
CviKI_1 RGCY 7 cut(s) 28, 66, 94, 127, 217, 223, 334
DdeI CTNAG 3 cut(s) 72, 219, 314
Eam1104I CTCTTC 1 cut(s) 165
EarI CTCTTC 1 cut(s) 165
Ecl136II GAGCTC 1 cut(s) 28
Eco24I GRGCYC 1 cut(s) 30
Eco31I GGTCTC 1 cut(s) 336
Eco47I GGWCC 1 cut(s) 76
Eco53kI GAGCTC 1 cut(s) 28
EcoICRI GAGCTC 1 cut(s) 28
EcoRI GAATTC 1 cut(s) 194
EcoT38I GRGCYC 1 cut(s) 30
FaeI CATG 1 cut(s) 262
FaiI YATR 7 cut(s) 62, 138, 177, 233, 260, 354, 356
FatI CATG 1 cut(s) 258
FauNDI CATATG 1 cut(s) 354
FokI GGATG 4 cut(s) 24, 101, 263, 293
FriOI GRGCYC 1 cut(s) 30
FspBI CTAG 1 cut(s) 183
Hin1II CATG 1 cut(s) 262
HindIII AAGCTT 1 cut(s) 64
Hpy166II GTNNAC 1 cut(s) 320
Hpy188III TCNNGA 1 cut(s) 86
Hpy8I GTNNAC 1 cut(s) 320
Hpy99I CGWCG 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 135
HpyCH4IV ACGT 1 cut(s) 201
HpyCH4V TGCA 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 3 cut(s) 34, 100, 187
HpyF3I CTNAG 3 cut(s) 72, 219, 314
HpySE526I ACGT 1 cut(s) 201
Hsp92II CATG 1 cut(s) 262
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 8 cut(s) 59, 71, 80, 92, 140, 196, 231, 352
LweI GCATC 1 cut(s) 46
MaeI CTAG 1 cut(s) 183
MaeII ACGT 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 253
MboII GAAGA 2 cut(s) 154, 182
MhlI GDGCHC 2 cut(s) 30, 315
MluCI AATT 3 cut(s) 43, 194, 226
MnlI CCTC 3 cut(s) 285, 297, 356
MseI TTAA 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 192
MwoI GCNNNNNNNGC 3 cut(s) 34, 100, 187
NdeI CATATG 1 cut(s) 354
NlaIII CATG 1 cut(s) 262
NlaIV GGNNCC 1 cut(s) 216
NmuCI GTSAC 1 cut(s) 253
PctI GAATGC 1 cut(s) 192
PflMI CCANNNNNTGG 1 cut(s) 85
Psp124BI GAGCTC 1 cut(s) 30
PspN4I GGNNCC 1 cut(s) 216
PspPI GGNCC 1 cut(s) 76
PstNI CAGNNNCTG 1 cut(s) 85
SacI GAGCTC 1 cut(s) 30
SaqAI TTAA 1 cut(s) 99
Sau96I GGNCC 1 cut(s) 76
SduI GDGCHC 2 cut(s) 30, 315
SfaNI GCATC 1 cut(s) 46
SinI GGWCC 1 cut(s) 76
Sse9I AATT 3 cut(s) 43, 194, 226
SspMI CTAG 1 cut(s) 183
SstI GAGCTC 1 cut(s) 30
TaaI ACNGT 1 cut(s) 135
TaiI ACGT 1 cut(s) 204
TaqI TCGA 1 cut(s) 198
TasI AATT 3 cut(s) 43, 194, 226
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 1 cut(s) 322
TseFI GTSAC 1 cut(s) 253
Tsp45I GTSAC 1 cut(s) 253
TspDTI ATGAA 3 cut(s) 17, 297, 341
TspRI CASTG 1 cut(s) 322
Van91I CCANNNNNTGG 1 cut(s) 85
VpaK11BI GGWCC 1 cut(s) 76
XapI RAATTY 1 cut(s) 194
XspI CTAG 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.