Rh5CG382300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001727
Physical Location & Seq
Reverse (-)
50025696 .. 50025983
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG382300.1

Sequence Viewer

Length: 288 bp
ATGGCAGCTCTGACTTACCCCACAGGAGGTAGTACGGATGAGAAGCAAGGCAGAGAGACAGCAACCTCAGTTTCTCGCAGGCATTCAGTCAGCTATATCCCTGATGTCAAAAATCCATCAAAACAGTCAGACCAGAAAGTGTCTAAACCAGAAAAAGATAGGATTCCAAATGTTATTGCAAAGCTGATGGGCCTGGATGAGCTTCCCAAAAATGAAAACGCAAAATCCACTACCACACAGAAAGACAACATATCCCCAAGAAACCAAGAGAAAGGGGAGCTACAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
VARLMGL

Protein Analysis

95

Amino Acids

10.5

Weight (kDa)

9.26

Isoelectric Point (pI)

45.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VARLMGL PF14383 54 - 71 6.2e-07 DUF761-associated sequence motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 26
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 5 cut(s) 8, 93, 184, 202, 280
AluI AGCT 5 cut(s) 8, 93, 184, 202, 280
Alw26I GTCTC 1 cut(s) 50
AoxI GGCC 1 cut(s) 190
ApeKI GCWGC 1 cut(s) 5
AspS9I GGNCC 1 cut(s) 190
BbvI GCAGC 1 cut(s) 17
BccI CCATC 2 cut(s) 124, 181
BciT130I CCWGG 1 cut(s) 194
BcoDI GTCTC 1 cut(s) 50
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 194
BmgT120I GGNCC 1 cut(s) 190
BmrFI CCNGG 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 194
BseGI GGATG 2 cut(s) 43, 202
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 81
BseXI GCAGC 1 cut(s) 17
BshFI GGCC 1 cut(s) 192
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 50
BsmI GAATGC 1 cut(s) 82
BsnI GGCC 1 cut(s) 192
BspANI GGCC 1 cut(s) 192
BspCNI CTCAG 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 126
BstC8I GCNNGC 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 67
BstF5I GGATG 2 cut(s) 43, 202
BstMAI GTCTC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 194
BstSCI CCNGG 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 17
BsuRI GGCC 1 cut(s) 192
BtsCI GGATG 2 cut(s) 43, 202
Cac8I GCNNGC 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 33
CviJI RGCY 6 cut(s) 8, 93, 184, 192, 202, 280
CviKI_1 RGCY 6 cut(s) 8, 93, 184, 192, 202, 280
CviQI GTAC 1 cut(s) 33
DdeI CTNAG 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 192
FaiI YATR 2 cut(s) 96, 251
Fnu4HI GCNGC 1 cut(s) 6
FokI GGATG 2 cut(s) 50, 209
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 1 cut(s) 192
HinfI GANTC 1 cut(s) 163
Hpy188I TCNGA 2 cut(s) 12, 130
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 179
HpyF3I CTNAG 1 cut(s) 67
LmnI GCTCC 1 cut(s) 277
LpnPI CCDG 7 cut(s) 9, 64, 114, 146, 162, 179, 206
Lsp1109I GCAGC 1 cut(s) 17
MnlI CCTC 2 cut(s) 20, 76
MspR9I CCNGG 1 cut(s) 194
Mva1269I GAATGC 1 cut(s) 82
MvaI CCWGG 1 cut(s) 194
PctI GAATGC 1 cut(s) 82
PfeI GAWTC 1 cut(s) 163
PkrI GCNGC 1 cut(s) 7
Psp6I CCWGG 1 cut(s) 192
PspGI CCWGG 1 cut(s) 192
PspPI GGNCC 1 cut(s) 190
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
SatI GCNGC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 190
ScrFI CCNGG 1 cut(s) 194
SetI ASST 7 cut(s) 10, 31, 68, 95, 186, 204, 282
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 126
TfiI GAWTC 1 cut(s) 163
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 228
TspGWI ACGGA 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.