Rmu_sc0008947.1_g000012

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008947.1
Physical Location & Seq
Reverse (-)
57130 .. 57447
318 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008947.1_g000012.1.cds

Sequence Viewer

Length: 318 bp
atgcaagtggcaacaaatggtttcagtaagttaataattaacgttgcaggaacccaatcaacccatgaagacaccttggatatttcatccacattgcaattggagcaacagaaggctttcaaatggagaaaacaagagccacttagagaaactgaaatccttctcaagcagatagtgatccagagccaactgttcctcaacacagcagaggcacttttcagactcgaaatccctctcggaattctccacgctagtagtagcgactacgatcatgagtacaactacatcactatcccgaagacattaagctcacattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.99

Weight (kDa)

5.73

Isoelectric Point (pI)

44.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 42
AclWI GGATC 1 cut(s) 172
AcsI RAATTY 1 cut(s) 240
AfaI GTAC 1 cut(s) 278
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 1 cut(s) 309
AluI AGCT 1 cut(s) 309
AlwI GGATC 1 cut(s) 172
ApoI RAATTY 1 cut(s) 240
Asp700I GAANNNNTTC 2 cut(s) 116, 159
BbsI GAAGAC 2 cut(s) 75, 305
BfaI CTAG 1 cut(s) 252
BmiI GGNNCC 1 cut(s) 52
BpiI GAAGAC 2 cut(s) 75, 305
BpuEI CTTGAG 1 cut(s) 149
BsaBI GATNNNNATC 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 75
Bse3DI GCAATG 1 cut(s) 92
Bse8I GATNNNNATC 1 cut(s) 176
BseDI CCNNGG 1 cut(s) 75
BseGI GGATG 1 cut(s) 86
BseJI GATNNNNATC 1 cut(s) 176
BseMI GCAATG 1 cut(s) 92
Bsp143I GATC 2 cut(s) 177, 268
BspHI TCATGA 1 cut(s) 271
BspLI GGNNCC 1 cut(s) 52
BspPI GGATC 1 cut(s) 172
BsrDI GCAATG 1 cut(s) 92
BssECI CCNNGG 1 cut(s) 75
BssMI GATC 2 cut(s) 177, 268
BssT1I CCWWGG 1 cut(s) 75
Bst4CI ACNGT 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 143
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 2 cut(s) 180, 271
BstMBI GATC 2 cut(s) 177, 268
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstV2I GAAGAC 2 cut(s) 75, 305
BtsCI GGATG 1 cut(s) 86
CciI TCATGA 1 cut(s) 271
Csp6I GTAC 1 cut(s) 277
CviAII CATG 2 cut(s) 65, 272
CviJI RGCY 4 cut(s) 116, 139, 186, 309
CviKI_1 RGCY 4 cut(s) 116, 139, 186, 309
CviQI GTAC 1 cut(s) 277
DdeI CTNAG 1 cut(s) 143
DpnI GATC 2 cut(s) 179, 270
DpnII GATC 2 cut(s) 177, 268
Eco130I CCWWGG 1 cut(s) 75
EcoRI GAATTC 1 cut(s) 240
EcoT14I CCWWGG 1 cut(s) 75
ErhI CCWWGG 1 cut(s) 75
FaeI CATG 2 cut(s) 68, 275
FaiI YATR 2 cut(s) 66, 273
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FatI CATG 2 cut(s) 64, 271
FokI GGATG 1 cut(s) 73
FspBI CTAG 1 cut(s) 252
Hin1II CATG 2 cut(s) 68, 275
HinfI GANTC 1 cut(s) 222
Hpy188I TCNGA 2 cut(s) 221, 239
Hpy188III TCNNGA 3 cut(s) 181, 272, 295
HpyAV CCTTC 2 cut(s) 106, 170
HpyCH4III ACNGT 1 cut(s) 192
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 3 cut(s) 4, 47, 97
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
HpyF3I CTNAG 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 2 cut(s) 68, 275
Kzo9I GATC 2 cut(s) 177, 268
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 2 cut(s) 33, 194
MaeI CTAG 1 cut(s) 252
MaeII ACGT 1 cut(s) 42
MalI GATC 2 cut(s) 179, 270
MboI GATC 2 cut(s) 177, 268
MboII GAAGA 2 cut(s) 80, 310
MfeI CAATTG 1 cut(s) 98
MluCI AATT 3 cut(s) 36, 98, 240
MlyI GAGTC 1 cut(s) 216
MnlI CCTC 3 cut(s) 202, 206, 243
MroXI GAANNNNTTC 2 cut(s) 116, 159
MseI TTAA 3 cut(s) 32, 39, 305
MunI CAATTG 1 cut(s) 98
MwoI GCNNNNNNNGC 1 cut(s) 103
NdeII GATC 2 cut(s) 177, 268
NlaIII CATG 2 cut(s) 68, 275
NlaIV GGNNCC 1 cut(s) 52
PagI TCATGA 1 cut(s) 271
PdmI GAANNNNTTC 2 cut(s) 116, 159
PleI GAGTC 1 cut(s) 216
PpsI GAGTC 1 cut(s) 216
Psp1406I AACGTT 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 52
RsaI GTAC 1 cut(s) 278
RsaNI GTAC 1 cut(s) 277
SaqAI TTAA 3 cut(s) 32, 39, 305
Sau3AI GATC 2 cut(s) 177, 268
SchI GAGTC 1 cut(s) 216
SetI ASST 3 cut(s) 45, 77, 311
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 3 cut(s) 36, 98, 240
SspMI CTAG 1 cut(s) 252
StyI CCWWGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 192
TaiI ACGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 225
TasI AATT 3 cut(s) 36, 98, 240
TatI WGTACW 1 cut(s) 276
Tru1I TTAA 3 cut(s) 32, 39, 305
Tru9I TTAA 3 cut(s) 32, 39, 305
TspDTI ATGAA 2 cut(s) 75, 81
XapI RAATTY 1 cut(s) 240
XcmI CCANNNNNNNNNTGG 1 cut(s) 97
XmnI GAANNNNTTC 2 cut(s) 116, 159
XspI CTAG 1 cut(s) 252
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.