Rmu_sc0012360.1_g000001
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012360.1
Physical Location & Seq
Reverse (-)
1 .. 954
954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012360.1_g000001.1.cds

Sequence Viewer

Length: 440 bp
atgacatgggattgctatattttcttcttgctgatttgtgcttctctttctcaggaaaatgtcaagacaaagcatccacagttgctgtatgagtcgaagttgtataaaatactacagggaggaactggaattccaaatgtgcgatggtttggcactgaaggagactacaatgttcttgtgatggatttattgggacctagtcttgaggatttattcaacttttgcagtaggaagttgtctcttaagactgttctcatgcttgcagatcaaatgataaatcgagtggagtttgttcattccaagtcttttctacatcgggatatcaaaccagacaagttcctaatgggattgggtcgtcgggcaaatcagatttacatcattgacttcggcctcgctaagaagtatagagacacatcaacccatcagcatattccttatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

146

Amino Acids

17.01

Weight (kDa)

8.97

Isoelectric Point (pI)

21.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 129
AcuI CTGAAG 1 cut(s) 177
AflII CTTAAG 1 cut(s) 242
AgsI TTSAA 1 cut(s) 217
AloI GAACNNNNNNTCC 2 cut(s) 115, 147
Alw26I GTCTC 3 cut(s) 156, 243, 402
AlwNI CAGNNNCTG 1 cut(s) 85
AoxI GGCC 1 cut(s) 388
ApoI RAATTY 1 cut(s) 129
AspS9I GGNCC 1 cut(s) 194
AvaII GGWCC 1 cut(s) 194
BccI CCATC 3 cut(s) 138, 175, 429
BcoDI GTCTC 3 cut(s) 156, 243, 402
BfaI CTAG 1 cut(s) 198
BfmI CTRYAG 1 cut(s) 113
BfrI CTTAAG 1 cut(s) 242
Bme18I GGWCC 1 cut(s) 194
BmgT120I GGNCC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 195
BmsI GCATC 1 cut(s) 82
BpuEI CTTGAG 1 cut(s) 224
BsaBI GATNNNNATC 1 cut(s) 374
Bse1I ACTGG 1 cut(s) 130
Bse8I GATNNNNATC 1 cut(s) 374
BseGI GGATG 1 cut(s) 73
BseJI GATNNNNATC 1 cut(s) 374
BseMII CTCAG 1 cut(s) 65
BseNI ACTGG 1 cut(s) 130
BshFI GGCC 1 cut(s) 390
BslFI GGGAC 1 cut(s) 207
BsmAI GTCTC 3 cut(s) 156, 243, 402
BsmFI GGGAC 1 cut(s) 207
BsnI GGCC 1 cut(s) 390
Bsp143I GATC 1 cut(s) 265
BspANI GGCC 1 cut(s) 390
BspCNI CTCAG 1 cut(s) 64
BspLI GGNNCC 1 cut(s) 195
BspTI CTTAAG 1 cut(s) 242
BsrI ACTGG 1 cut(s) 130
BssMI GATC 1 cut(s) 265
Bst4CI ACNGT 2 cut(s) 81, 250
BstAFI CTTAAG 1 cut(s) 242
BstC8I GCNNGC 1 cut(s) 261
BstDEI CTNAG 2 cut(s) 51, 396
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 1 cut(s) 268
BstMAI GTCTC 3 cut(s) 156, 243, 402
BstMBI GATC 1 cut(s) 265
BstSFI CTRYAG 1 cut(s) 113
BsuRI GGCC 1 cut(s) 390
BtgZI GCGATG 1 cut(s) 157
BtsCI GGATG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 261
CaiI CAGNNNCTG 1 cut(s) 85
Cfr13I GGNCC 1 cut(s) 194
CviAII CATG 2 cut(s) 6, 256
CviJI RGCY 1 cut(s) 390
CviKI_1 RGCY 1 cut(s) 390
DdeI CTNAG 2 cut(s) 51, 396
DpnI GATC 1 cut(s) 267
DpnII GATC 1 cut(s) 265
Eco32I GATATC 1 cut(s) 322
Eco47I GGWCC 1 cut(s) 194
Eco57I CTGAAG 1 cut(s) 177
EcoO109I RGGNCCY 1 cut(s) 194
EcoRI GAATTC 1 cut(s) 129
EcoRV GATATC 1 cut(s) 322
FaeI CATG 2 cut(s) 9, 259
FaiI YATR 8 cut(s) 7, 18, 90, 105, 257, 405, 429, 438
FaqI GGGAC 1 cut(s) 207
FatI CATG 2 cut(s) 5, 255
FokI GGATG 1 cut(s) 60
FspBI CTAG 1 cut(s) 198
HaeIII GGCC 1 cut(s) 390
Hin1II CATG 2 cut(s) 9, 259
HinfI GANTC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 369
Hpy188III TCNNGA 4 cut(s) 53, 64, 203, 317
Hpy99I CGWCG 1 cut(s) 360
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 2 cut(s) 81, 250
HpyCH4V TGCA 2 cut(s) 225, 263
HpyF3I CTNAG 2 cut(s) 51, 396
Hsp92II CATG 2 cut(s) 9, 259
Kzo9I GATC 1 cut(s) 265
LpnPI CCDG 4 cut(s) 38, 101, 111, 342
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 198
MalI GATC 1 cut(s) 267
MboI GATC 1 cut(s) 265
MboII GAAGA 1 cut(s) 16
MluCI AATT 1 cut(s) 129
MlyI GAGTC 1 cut(s) 101
MnlI CCTC 3 cut(s) 113, 199, 401
MseI TTAA 1 cut(s) 243
MspCI CTTAAG 1 cut(s) 242
NdeII GATC 1 cut(s) 265
NlaIII CATG 2 cut(s) 9, 259
NlaIV GGNNCC 1 cut(s) 195
PflFI GACNNNGTC 1 cut(s) 198
PleI GAGTC 1 cut(s) 100
PpsI GAGTC 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 194
Psp5II RGGWCCY 1 cut(s) 194
PspN4I GGNNCC 1 cut(s) 195
PspPI GGNCC 1 cut(s) 194
PspPPI RGGWCCY 1 cut(s) 194
PstNI CAGNNNCTG 1 cut(s) 85
PsyI GACNNNGTC 1 cut(s) 198
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 1 cut(s) 265
Sau96I GGNCC 1 cut(s) 194
SchI GAGTC 1 cut(s) 101
SetI ASST 1 cut(s) 199
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 113
SinI GGWCC 1 cut(s) 194
SmlI CTYRAG 2 cut(s) 203, 242
SmoI CTYRAG 2 cut(s) 203, 242
Sse9I AATT 1 cut(s) 129
SspMI CTAG 1 cut(s) 198
TaaI ACNGT 2 cut(s) 81, 250
TaqI TCGA 2 cut(s) 95, 280
TasI AATT 1 cut(s) 129
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 1 cut(s) 160
TspDTI ATGAA 1 cut(s) 284
TspRI CASTG 1 cut(s) 160
Tth111I GACNNNGTC 1 cut(s) 198
Vha464I CTTAAG 1 cut(s) 242
VpaK11BI GGWCC 1 cut(s) 194
XapI RAATTY 1 cut(s) 129
XcmI CCANNNNNNNNNTGG 1 cut(s) 141
XspI CTAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.