Rorug02G0385600
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
49205156 .. 49205326
171 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0385600.1

Sequence Viewer

Length: 171 bp
ATGACCAGTATTCATGGAGTGCAAATTCTACATGCACCTAGAAGTTGTAATACTGTGGCACATAGACTAGCTAGCATAGCTTTTGAGTCTGATCAACAGGAGTTTTGGCTCCATAGTGAGCCAAATTGCATACTTCATGTAGTACAACACGATTGTAACCATGACACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.38

Weight (kDa)

5.88

Isoelectric Point (pI)

45.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 24
AfaI GTAC 1 cut(s) 144
AluBI AGCT 2 cut(s) 71, 80
AluI AGCT 2 cut(s) 71, 80
ApoI RAATTY 1 cut(s) 24
AsuNHI GCTAGC 1 cut(s) 71
BarI GAAGNNNNNNTAC 2 cut(s) 34, 66
BclI TGATCA 1 cut(s) 91
BfaI CTAG 3 cut(s) 39, 68, 72
BmiI GGNNCC 1 cut(s) 110
BmtI GCTAGC 1 cut(s) 75
Bse1I ACTGG 1 cut(s) 6
BseNI ACTGG 1 cut(s) 6
Bsp143I GATC 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 110
BspOI GCTAGC 1 cut(s) 75
BsrI ACTGG 1 cut(s) 6
BssMI GATC 1 cut(s) 91
Bst4CI ACNGT 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 73
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNSI RCATGY 1 cut(s) 35
Cac8I GCNNGC 1 cut(s) 73
Csp6I GTAC 1 cut(s) 143
CviAII CATG 4 cut(s) 14, 32, 137, 161
CviJI RGCY 4 cut(s) 71, 80, 109, 121
CviKI_1 RGCY 4 cut(s) 71, 80, 109, 121
CviQI GTAC 1 cut(s) 143
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaeI CATG 4 cut(s) 17, 35, 140, 164
FaiI YATR 8 cut(s) 15, 33, 63, 77, 114, 131, 138, 162
FatI CATG 4 cut(s) 13, 31, 136, 160
FbaI TGATCA 1 cut(s) 91
FspBI CTAG 3 cut(s) 39, 68, 72
FspEI CC 7 cut(s) 19, 41, 51, 83, 91, 125, 135
Hin1II CATG 4 cut(s) 17, 35, 140, 164
HinfI GANTC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 3 cut(s) 22, 35, 129
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
Hsp92II CATG 4 cut(s) 17, 35, 140, 164
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 114
LpnPI CCDG 2 cut(s) 19, 83
MaeI CTAG 3 cut(s) 39, 68, 72
MaeIII GTNAC 1 cut(s) 155
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MluCI AATT 2 cut(s) 24, 124
MlyI GAGTC 1 cut(s) 95
MseI TTAA 1 cut(s) 169
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeII GATC 1 cut(s) 91
NheI GCTAGC 1 cut(s) 71
NlaIII CATG 4 cut(s) 17, 35, 140, 164
NlaIV GGNNCC 1 cut(s) 110
NspI RCATGY 1 cut(s) 35
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 110
RsaI GTAC 1 cut(s) 144
RsaNI GTAC 1 cut(s) 143
SaqAI TTAA 1 cut(s) 169
Sau3AI GATC 1 cut(s) 91
SchI GAGTC 1 cut(s) 95
SetI ASST 3 cut(s) 40, 73, 82
SgeI CNNG 9 cut(s) 18, 26, 44, 51, 80, 84, 110, 149, 161
Sse9I AATT 2 cut(s) 24, 124
SspMI CTAG 3 cut(s) 39, 68, 72
TaaI ACNGT 1 cut(s) 55
TasI AATT 2 cut(s) 24, 124
TatI WGTACW 1 cut(s) 142
Tru1I TTAA 1 cut(s) 169
Tru9I TTAA 1 cut(s) 169
TspDTI ATGAA 1 cut(s) 125
XapI RAATTY 1 cut(s) 24
XceI RCATGY 1 cut(s) 35
XspI CTAG 3 cut(s) 39, 68, 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.