Rmu_sc0017310.1_g000001

Activating signal cointegrator 1 complex subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017310.1
Physical Location & Seq
Reverse (-)
1 .. 564
564 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017310.1_g000001.1.cds

Sequence Viewer

Length: 196 bp
atgggagagagaggcgagtgggtgtcgaccaagggaaatttcgtgaattacttgccccaagatgaggcggtttccgctagcctaggggccgacgaaggtggattggatgccgtggagtctcagagagtcgtcgatcttctcaatagagagctttctcgattgctcaagctaaaccctaaggaattttggaaacaag

Protein Analysis

65

Amino Acids

7.29

Weight (kDa)

4.76

Isoelectric Point (pI)

13.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 26
AciI CCGC 2 cut(s) 68, 75
AcsI RAATTY 2 cut(s) 37, 182
AfiI CCNNNNNNNGG 1 cut(s) 64
AjuI GAANNNNNNNTTGG 2 cut(s) 23, 55
AluBI AGCT 2 cut(s) 151, 169
AluI AGCT 2 cut(s) 151, 169
Alw26I GTCTC 1 cut(s) 123
AoxI GGCC 1 cut(s) 87
ApoI RAATTY 2 cut(s) 37, 182
AspA2I CCTAGG 1 cut(s) 82
AspS9I GGNCC 1 cut(s) 87
AsuNHI GCTAGC 1 cut(s) 77
AvrII CCTAGG 1 cut(s) 82
AxyI CCTNAGG 1 cut(s) 177
BceAI ACGGC 1 cut(s) 95
BcoDI GTCTC 1 cut(s) 123
BfaI CTAG 2 cut(s) 78, 83
BlnI CCTAGG 1 cut(s) 82
BmgT120I GGNCC 1 cut(s) 87
BmiI GGNNCC 1 cut(s) 88
BmsI GCATC 1 cut(s) 97
BmtI GCTAGC 1 cut(s) 81
BpuEI CTTGAG 1 cut(s) 149
BsaJI CCNNGG 3 cut(s) 30, 82, 111
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse21I CCTNAGG 1 cut(s) 177
BseDI CCNNGG 3 cut(s) 30, 82, 111
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 134
BshFI GGCC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 64
BsmAI GTCTC 1 cut(s) 123
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 133
BspACI CCGC 2 cut(s) 68, 75
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 133
BspLI GGNNCC 1 cut(s) 88
BspOI GCTAGC 1 cut(s) 81
BssECI CCNNGG 3 cut(s) 30, 82, 111
BssMI GATC 1 cut(s) 133
BssT1I CCWWGG 2 cut(s) 30, 82
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 2 cut(s) 120, 177
BstDSI CCRYGG 1 cut(s) 111
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 1 cut(s) 136
BstMAI GTCTC 1 cut(s) 123
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 74
Bsu36I CCTNAGG 1 cut(s) 177
BsuRI GGCC 1 cut(s) 89
BtgI CCRYGG 1 cut(s) 111
BtsCI GGATG 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 79
Cfr13I GGNCC 1 cut(s) 87
CviJI RGCY 4 cut(s) 81, 89, 151, 169
CviKI_1 RGCY 4 cut(s) 81, 89, 151, 169
DdeI CTNAG 2 cut(s) 120, 177
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
Eco130I CCWWGG 2 cut(s) 30, 82
Eco81I CCTNAGG 1 cut(s) 177
EcoT14I CCWWGG 2 cut(s) 30, 82
ErhI CCWWGG 2 cut(s) 30, 82
FblI GTMKAC 1 cut(s) 26
FokI GGATG 1 cut(s) 119
FspBI CTAG 2 cut(s) 78, 83
HaeIII GGCC 1 cut(s) 89
HincII GTYRAC 1 cut(s) 27
HindII GTYRAC 1 cut(s) 27
HinfI GANTC 2 cut(s) 116, 126
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 123
Hpy188III TCNNGA 2 cut(s) 43, 156
Hpy8I GTNNAC 1 cut(s) 27
Hpy99I CGWCG 2 cut(s) 95, 134
HpyAV CCTTC 1 cut(s) 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 2 cut(s) 120, 177
Kzo9I GATC 1 cut(s) 133
LweI GCATC 1 cut(s) 97
MaeI CTAG 2 cut(s) 78, 83
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 128
MluCI AATT 3 cut(s) 37, 46, 182
MlyI GAGTC 2 cut(s) 125, 135
MnlI CCTC 2 cut(s) 5, 58
MwoI GCNNNNNNNGC 1 cut(s) 74
NdeII GATC 1 cut(s) 133
NheI GCTAGC 1 cut(s) 77
NlaIV GGNNCC 1 cut(s) 88
PleI GAGTC 2 cut(s) 124, 134
PpsI GAGTC 2 cut(s) 124, 134
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 87
SalI GTCGAC 1 cut(s) 25
Sau3AI GATC 1 cut(s) 133
Sau96I GGNCC 1 cut(s) 87
SchI GAGTC 2 cut(s) 125, 135
SetI ASST 3 cut(s) 100, 153, 171
SfaNI GCATC 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 3 cut(s) 37, 46, 182
SsiI CCGC 2 cut(s) 68, 75
SspMI CTAG 2 cut(s) 78, 83
StyI CCWWGG 2 cut(s) 30, 82
TaqI TCGA 3 cut(s) 26, 132, 157
TasI AATT 3 cut(s) 37, 46, 182
XapI RAATTY 2 cut(s) 37, 182
XmaJI CCTAGG 1 cut(s) 82
XmiI GTMKAC 1 cut(s) 26
XspI CTAG 2 cut(s) 78, 83
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.