Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0019163.1

Orthogroup ID

OG0002810

Physical Location & Seq

Genomic Coordinates Forward (+)

8102 .. 9077

Gene Structure 976 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0019163.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 906 bp

ctgtggagatttgacttcggtttttgtggcggtggcgaaggtgtttgcggtggtggctttggctctgtgcaccaccaagttcgccgttgggatcacgctgtctgcttttctgcttttgtttctggaatgcgtgggatcggctatgcagtattggttttgaggagtgatgtgattgtgaaagaaaagagtgacggtgttgtgtttgaattggttgaacctggggttgaatcagactcttcatttgaagagattgaggtcgtggagcttaagagtagtggtagtgtgcgtattgatgaaggtattggtcagaagagtttgattgagtatttgaatatggatggtgagaagtcggagaagattgagacgggtgatcatacagatgacttgtcggtttcggtttgtaagaagagtaagagtaagggtagaaagaggtgtgtgtctaatatgggagcaaagcttatcaagaggtttgtgcctaagaaattgcgtaagaagaatcggtctggggcggagccggagccaaagccaagcagtgaatcttgtgttgacatagcagaagagggattggtagaacaagaaagccaaagagaagggttcagtgctgaggaagtagaaagtgaaaacagttcaatggtgtcagtaaattcagtaaacaagtgtgaaaaacaagaagctgatggaatagtaacttcattgattgttggaaagaagggaacagaaagcaaaaggaattttgggtatctgattctgtttttgatagctcttgctggacttgttggaggtcgggttttagctctgttgcttataatcacttggtgctttatgttgaaggtgattaggtcttggagcagttcaggcgatatgcccctccccctgaaaaggtgttctttcccaatttccttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

301

Amino Acids

32.9

Weight (kDa)

6.54

Isoelectric Point (pI)

47.34

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002810)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G20880 AT5G44350
fragaria_vesca	FvH4_3g10700 FvH4_3g10700 FvH4_3g10700 FvH4_3g10700 FvH4_6g34930
malus_domestica	MD05G1269300.v1.1 MD10G1248100.v1.1
prunus_persica	Prupe.4G095400_v2.0.a1 Prupe.4G095400_v2.0.a1 Prupe.4G095400_v2.0.a1
pyrus_communis	pycom05g25210 pycom10g20560
rosa_chinensis	RchiOBHm_Chr2g0145901 RchiOBHm_Chr5g0017411
rosa_laevigata	RLG00000020172 RLG00000032285 RLG00000036255
rosa_multiflora	Rmu_sc0001173.1_g000015 Rmu_sc0001702.1_g000004 Rmu_sc0007392.1_g000006 Rmu_sc0019163.1_g000001 Rmu_sc0039295.1_g000001
rosa_roxburghii	Rroxscaffold_152G00434790 Rroxscaffold_1G00059980 Rroxscaffold_2G00100390 Rroxscaffold_4G00332040
rosa_rugosa	Rorug05G0035100 Rorug05G0035200
rosa_samantha	Rh2AG448100 Rh2CG435100 Rh5AG130100 Rh5BG127800 Rh5CG140600 Rh5DG130200 Rh5DG339900
rosa_wichuraiana	Rw2G036610 Rw5G011220

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	806
AciI	CCGC	3 cut(s)	30, 48, 509
AclWI	GGATC	2 cut(s)	99, 143
AcsI	RAATTY	2 cut(s)	643, 730
AdeI	CACNNNGTG	1 cut(s)	816
AfiI	CCNNNNNNNGG	1 cut(s)	879
AflII	CTTAAG	1 cut(s)	266
AgsI	TTSAA	7 cut(s)	206, 215, 227, 245, 331, 630, 829
AjnI	CCWGG	1 cut(s)	217
AluBI	AGCT	5 cut(s)	265, 457, 674, 761, 794
AluI	AGCT	5 cut(s)	265, 457, 674, 761, 794
Alw21I	GWGCWC	1 cut(s)	72
Alw26I	GTCTC	1 cut(s)	356
Alw44I	GTGCAC	1 cut(s)	68
AlwI	GGATC	2 cut(s)	99, 143
ApaLI	GTGCAC	1 cut(s)	68
ApoI	RAATTY	2 cut(s)	643, 730
ArsI	GACNNNNNNTTYG	2 cut(s)	224, 256
AsuHPI	GGTGA	3 cut(s)	353, 380, 844
BaeGI	GKGCMC	1 cut(s)	72
Bbv12I	GWGCWC	1 cut(s)	72
BbvCI	CCTCAGC	1 cut(s)	603
BccI	CCATC	2 cut(s)	332, 671
BceAI	ACGGC	1 cut(s)	69
BciT130I	CCWGG	1 cut(s)	219
BclI	TGATCA	1 cut(s)	370
BcoDI	GTCTC	1 cut(s)	356
BfrI	CTTAAG	1 cut(s)	266
Bme1390I	CCNGG	1 cut(s)	219
BmiI	GGNNCC	2 cut(s)	513, 519
BmrFI	CCNGG	1 cut(s)	219
Bpu10I	CCTNAGC	1 cut(s)	603
BsaJI	CCNNGG	1 cut(s)	218
BsaXI	ACNNNNNCTCC	2 cut(s)	771, 801
Bsc4I	CCNNNNNNNGG	1 cut(s)	879
BseBI	CCWGG	1 cut(s)	219
BseDI	CCNNGG	1 cut(s)	218
BseGI	GGATG	1 cut(s)	343
BseLI	CCNNNNNNNGG	1 cut(s)	879
BseMII	CTCAG	1 cut(s)	594
BseRI	GAGGAG	1 cut(s)	175
BseSI	GKGCMC	1 cut(s)	72
BsiHKAI	GWGCWC	1 cut(s)	72
BsiSI	CCGG	1 cut(s)	515
BslI	CCNNNNNNNGG	1 cut(s)	879
BsmAI	GTCTC	1 cut(s)	356
BsmBI	CGTCTC	1 cut(s)	356
BsmI	GAATGC	1 cut(s)	132
Bsp1286I	GDGCHC	1 cut(s)	72
Bsp143I	GATC	3 cut(s)	91, 135, 370
BspACI	CCGC	3 cut(s)	30, 48, 509
BspCNI	CTCAG	1 cut(s)	595
BspLI	GGNNCC	2 cut(s)	513, 519
BspPI	GGATC	2 cut(s)	99, 143
BspTI	CTTAAG	1 cut(s)	266
BssECI	CCNNGG	1 cut(s)	218
BssMI	GATC	3 cut(s)	91, 135, 370
Bst2UI	CCWGG	1 cut(s)	219
Bst4CI	ACNGT	2 cut(s)	194, 626
Bst6I	CTCTTC	5 cut(s)	240, 241, 305, 401, 552
BstAFI	CTTAAG	1 cut(s)	266
BstDEI	CTNAG	2 cut(s)	477, 603
BstF5I	GGATG	1 cut(s)	343
BstKTI	GATC	3 cut(s)	94, 138, 373
BstMAI	GTCTC	1 cut(s)	356
BstMBI	GATC	3 cut(s)	91, 135, 370
BstMWI	GCNNNNNNNGC	2 cut(s)	54, 855
BstNI	CCWGG	1 cut(s)	219
BstSCI	CCNGG	1 cut(s)	217
BstSLI	GKGCMC	1 cut(s)	72
BtsCI	GGATG	1 cut(s)	343
BtsI	GCAGTG	1 cut(s)	538
BtsIMutI	CAGTG	2 cut(s)	538, 604
DdeI	CTNAG	2 cut(s)	477, 603
DpnI	GATC	3 cut(s)	93, 137, 372
DpnII	GATC	3 cut(s)	91, 135, 370
DraIII	CACNNNGTG	1 cut(s)	816
Eam1104I	CTCTTC	5 cut(s)	240, 241, 305, 401, 552
EarI	CTCTTC	5 cut(s)	240, 241, 305, 401, 552
EciI	GGCGGA	1 cut(s)	524
EcoRII	CCWGG	1 cut(s)	217
Esp3I	CGTCTC	1 cut(s)	356
FaiI	YATR	8 cut(s)	144, 335, 375, 446, 551, 806, 824, 863
FalI	AAGNNNNNCTT	2 cut(s)	871, 903
FbaI	TGATCA	1 cut(s)	370
FokI	GGATG	1 cut(s)	350
HapII	CCGG	1 cut(s)	515
HincII	GTYRAC	1 cut(s)	547
HindII	GTYRAC	1 cut(s)	547
HindIII	AAGCTT	1 cut(s)	455
HinfI	GANTC	5 cut(s)	227, 233, 496, 536, 745
HpaII	CCGG	1 cut(s)	515
HphI	GGTGA	3 cut(s)	353, 380, 844
Hpy166II	GTNNAC	3 cut(s)	70, 547, 652
Hpy188I	TCNGA	4 cut(s)	232, 309, 352, 744
Hpy188III	TCNNGA	2 cut(s)	123, 463
Hpy8I	GTNNAC	3 cut(s)	70, 547, 652
HpyAV	CCTTC	5 cut(s)	32, 290, 584, 703, 823
HpyCH4III	ACNGT	2 cut(s)	194, 626
HpyCH4V	TGCA	2 cut(s)	70, 146
HpyF10VI	GCNNNNNNNGC	2 cut(s)	54, 855
HpyF3I	CTNAG	2 cut(s)	477, 603
Ksp22I	TGATCA	1 cut(s)	370
Kzo9I	GATC	3 cut(s)	91, 135, 370
LmnI	GCTCC	5 cut(s)	262, 449, 511, 517, 846
LpnPI	CCDG	8 cut(s)	108, 204, 231, 489, 528, 753, 840, 887
MaeIII	GTNAC	2 cut(s)	188, 685
MalI	GATC	3 cut(s)	93, 137, 372
MboI	GATC	3 cut(s)	91, 135, 370
MboII	GAAGA	7 cut(s)	228, 257, 322, 367, 418, 505, 569
MhlI	GDGCHC	1 cut(s)	72
MluCI	AATT	5 cut(s)	206, 482, 643, 730, 894
MlyI	GAGTC	1 cut(s)	227
MmeI	TCCRAC	3 cut(s)	330, 682, 757
MnlI	CCTC	8 cut(s)	153, 247, 423, 459, 553, 598, 773, 878
MseI	TTAA	1 cut(s)	267
MslI	CAYNNNNRTG	1 cut(s)	378
MspCI	CTTAAG	1 cut(s)	266
MspI	CCGG	1 cut(s)	515
MspR9I	CCNGG	1 cut(s)	219
Mva1269I	GAATGC	1 cut(s)	132
MvaI	CCWGG	1 cut(s)	219
MwoI	GCNNNNNNNGC	2 cut(s)	54, 855
NdeII	GATC	3 cut(s)	91, 135, 370
NlaIV	GGNNCC	2 cut(s)	513, 519
NmuCI	GTSAC	1 cut(s)	188
PctI	GAATGC	1 cut(s)	132
PfeI	GAWTC	4 cut(s)	227, 496, 536, 745
PleI	GAGTC	1 cut(s)	227
PpsI	GAGTC	1 cut(s)	227
PsiI	TTATAA	1 cut(s)	806
Psp6I	CCWGG	1 cut(s)	217
PspGI	CCWGG	1 cut(s)	217
PspN4I	GGNNCC	2 cut(s)	513, 519
RseI	CAYNNNNRTG	1 cut(s)	378
SaqAI	TTAA	1 cut(s)	267
Sau3AI	GATC	3 cut(s)	91, 135, 370
SchI	GAGTC	1 cut(s)	227
ScrFI	CCNGG	1 cut(s)	219
SduI	GDGCHC	1 cut(s)	72
SmiMI	CAYNNNNRTG	1 cut(s)	378
SmlI	CTYRAG	1 cut(s)	266
SmoI	CTYRAG	1 cut(s)	266
Sse9I	AATT	5 cut(s)	206, 482, 643, 730, 894
SsiI	CCGC	3 cut(s)	30, 48, 509
StyD4I	CCNGG	1 cut(s)	217
TaaI	ACNGT	2 cut(s)	194, 626
TaqII	GACCGA	1 cut(s)	489
TasI	AATT	5 cut(s)	206, 482, 643, 730, 894
TfiI	GAWTC	4 cut(s)	227, 496, 536, 745
Tru1I	TTAA	1 cut(s)	267
Tru9I	TTAA	1 cut(s)	267
TscAI	CASTG	2 cut(s)	538, 604
TseFI	GTSAC	1 cut(s)	188
Tsp45I	GTSAC	1 cut(s)	188
TspDTI	ATGAA	3 cut(s)	228, 309, 681
TspRI	CASTG	2 cut(s)	538, 604
Vha464I	CTTAAG	1 cut(s)	266
VneI	GTGCAC	1 cut(s)	68
XapI	RAATTY	2 cut(s)	643, 730

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.