Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0030932.1

Orthogroup ID

OG0004526

Physical Location & Seq

Genomic Coordinates Forward (+)

18714 .. 20146

Gene Structure 1433 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0030932.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 825 bp

atgggaagaaactcaggtttcgaaaaggagggattgaagaaaggtatgtggtctgctcgcgaagaccaggttctcaagaactatgtgaaaaagcacggtccaggcaactggggaaaaacagcaagggagactggtctgaagagatgtgggaagagtgtgagactgagatggttaaattatctgaggcccggtatcaagaaaggcaacattacagaagatgaagaagaccttattatcaggatgcacaaactcgtaggcaacaggtggtcattgatagcaggaaggattccggaccgaacagacaacgaaataaaaaactactggaactccactctaaggaagaagctggcagaggaaaaagaaacggaatcagaagtgtcgagaaacgagatgatcaaggagaacttgccatcccccgttgaggactatggtcatcaacatttgaccaaatgcgatgtagttcttggcggaggaggaggattgatgtgttttgccagtaatgttaatgcagaagaagatcatcagcgtcgttgtcttggcggtactagtaccgatactactatactgagtcccagagtgggagtgggagtcggaaccggaggcggggcaaacaataatatcgaaccaactggggatgatctcaattataacgctatgacctggaacgattcgataatggatgtgaatggaggccaactctacatgtctgaattcctccaaactgacttttcgaagttttgggaagaaacagataggttcatgaattttgaagtcggaggttgcagcacctttaatcatgagttgccaaataattgggatggttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

274

Amino Acids

30.86

Weight (kDa)

5.94

Isoelectric Point (pI)

47.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004526)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g31070 FvH4_2g31070 FvH4_4g02400
rosa_chinensis	RchiOBHm_Chr4g0389841 RchiOBHm_Chr5g0019651 RchiOBHm_Chr6g0311731
rosa_laevigata	RLG00000009947 RLG00000010379
rosa_multiflora	Rmu_co8139852.1_g000001 Rmu_sc0002702.1_g000022 Rmu_sc0002888.1_g000030 Rmu_sc0030932.1_g000007
rosa_roxburghii	Rroxscaffold_1G00058440 Rroxscaffold_5G00335890 Rroxscaffold_5G00335920 Rroxscaffold_7G00157360
rosa_rugosa	Rorug03G0325700 Rorug03G0326000 Rorug03G0326100 Rorug03G0326200 Rorug05G0052400
rosa_samantha	Rh4AG030400 Rh4BG023600 Rh4CG033000 Rh5AG143000 Rh5BG141600 Rh5CG153600 Rh6BG517200 Rh6DG508800
rosa_wichuraiana	Rw4G002290 Rw5G012670 Rw6G044060

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	648
AccII	CGCG	1 cut(s)	60
AccIII	TCCGGA	1 cut(s)	289
AciI	CCGC	3 cut(s)	468, 540, 603
AcsI	RAATTY	2 cut(s)	710, 763
AcuI	CTGAAG	1 cut(s)	158
AfaI	GTAC	2 cut(s)	544, 550
AfiI	CCNNNNNNNGG	4 cut(s)	336, 421, 578, 603
AflIII	ACRYGT	1 cut(s)	702
AgsI	TTSAA	2 cut(s)	37, 770
AhlI	ACTAGT	1 cut(s)	545
AjnI	CCWGG	3 cut(s)	66, 100, 659
AloI	GAACNNNNNNTCC	2 cut(s)	395, 427
AluBI	AGCT	1 cut(s)	346
AluI	AGCT	1 cut(s)	346
Alw26I	GTCTC	2 cut(s)	122, 154
Aor13HI	TCCGGA	1 cut(s)	289
AoxI	GGCC	2 cut(s)	185, 691
ApeKI	GCWGC	1 cut(s)	783
ApoI	RAATTY	2 cut(s)	710, 763
AspS9I	GGNCC	3 cut(s)	98, 186, 292
AsuC2I	CCSGG	1 cut(s)	189
AsuII	TTCGAA	2 cut(s)	21, 731
AvaII	GGWCC	2 cut(s)	98, 292
BbsI	GAAGAC	2 cut(s)	69, 231
BbvI	GCAGC	1 cut(s)	795
BccI	CCATC	3 cut(s)	162, 418, 812
BciT130I	CCWGG	3 cut(s)	68, 102, 661
BclI	TGATCA	1 cut(s)	393
BcnI	CCSGG	1 cut(s)	189
BcoDI	GTCTC	2 cut(s)	122, 154
BcuI	ACTAGT	1 cut(s)	545
BfaI	CTAG	1 cut(s)	546
BisI	GCNGC	1 cut(s)	784
BlsI	GCNGC	1 cut(s)	785
Bme1390I	CCNGG	4 cut(s)	68, 102, 189, 661
Bme18I	GGWCC	2 cut(s)	98, 292
BmgT120I	GGNCC	3 cut(s)	98, 186, 292
BmiI	GGNNCC	1 cut(s)	595
BmrFI	CCNGG	4 cut(s)	68, 102, 189, 661
BmrI	ACTGGG	2 cut(s)	118, 639
BmsI	GCATC	1 cut(s)	231
BmuI	ACTGGG	2 cut(s)	118, 639
BoxI	GACNNNNGTC	1 cut(s)	429
BpiI	GAAGAC	2 cut(s)	69, 231
BplI	GAGNNNNNCTC	2 cut(s)	681, 713
Bpu14I	TTCGAA	2 cut(s)	21, 731
BpuEI	CTTGAG	1 cut(s)	59
BpuMI	CCSGG	1 cut(s)	189
BsaWI	WCCGGW	2 cut(s)	289, 596
BsaXI	ACNNNNNCTCC	4 cut(s)	311, 341, 573, 603
Bsc4I	CCNNNNNNNGG	4 cut(s)	336, 421, 578, 603
Bse1I	ACTGG	5 cut(s)	113, 136, 326, 495, 634
BseAI	TCCGGA	1 cut(s)	289
BseBI	CCWGG	3 cut(s)	68, 102, 661
BseGI	GGATG	5 cut(s)	246, 410, 640, 685, 823
BseLI	CCNNNNNNNGG	4 cut(s)	336, 421, 578, 603
BseMII	CTCAG	4 cut(s)	27, 155, 173, 557
BseNI	ACTGG	5 cut(s)	113, 136, 326, 495, 634
BseRI	GAGGAG	2 cut(s)	486, 489
BseXI	GCAGC	1 cut(s)	795
Bsh1236I	CGCG	1 cut(s)	60
BshFI	GGCC	2 cut(s)	187, 693
BsiSI	CCGG	3 cut(s)	189, 290, 597
BslFI	GGGAC	1 cut(s)	555
BslI	CCNNNNNNNGG	4 cut(s)	336, 421, 578, 603
BsmAI	GTCTC	2 cut(s)	122, 154
BsmFI	GGGAC	1 cut(s)	555
BsnI	GGCC	2 cut(s)	187, 693
Bsp119I	TTCGAA	2 cut(s)	21, 731
Bsp13I	TCCGGA	1 cut(s)	289
Bsp143I	GATC	3 cut(s)	393, 517, 637
Bsp68I	TCGCGA	1 cut(s)	60
BspACI	CCGC	3 cut(s)	468, 540, 603
BspANI	GGCC	2 cut(s)	187, 693
BspCNI	CTCAG	4 cut(s)	26, 156, 174, 558
BspEI	TCCGGA	1 cut(s)	289
BspFNI	CGCG	1 cut(s)	60
BspHI	TCATGA	2 cut(s)	759, 796
BspLI	GGNNCC	1 cut(s)	595
BspT104I	TTCGAA	2 cut(s)	21, 731
BsrI	ACTGG	5 cut(s)	113, 136, 326, 495, 634
BssMI	GATC	3 cut(s)	393, 517, 637
Bst2UI	CCWGG	3 cut(s)	68, 102, 661
Bst4CI	ACNGT	1 cut(s)	98
Bst6I	CTCTTC	2 cut(s)	134, 146
BstBI	TTCGAA	2 cut(s)	21, 731
BstC8I	GCNNGC	2 cut(s)	58, 348
BstDEI	CTNAG	5 cut(s)	13, 164, 182, 335, 566
BstF5I	GGATG	5 cut(s)	246, 410, 640, 685, 823
BstFNI	CGCG	1 cut(s)	60
BstKTI	GATC	3 cut(s)	396, 520, 640
BstMAI	GTCTC	2 cut(s)	122, 154
BstMBI	GATC	3 cut(s)	393, 517, 637
BstNI	CCWGG	3 cut(s)	68, 102, 661
BstNSI	RCATGY	1 cut(s)	706
BstPAI	GACNNNNGTC	1 cut(s)	429
BstSCI	CCNGG	4 cut(s)	66, 100, 187, 659
BstUI	CGCG	1 cut(s)	60
BstV1I	GCAGC	1 cut(s)	795
BstV2I	GAAGAC	2 cut(s)	69, 231
BstXI	CCANNNNNNTGG	2 cut(s)	108, 813
BsuRI	GGCC	2 cut(s)	187, 693
BtgZI	GCGATG	1 cut(s)	468
BtsCI	GGATG	5 cut(s)	246, 410, 640, 685, 823
BtuMI	TCGCGA	1 cut(s)	60
Cac8I	GCNNGC	2 cut(s)	58, 348
CciI	TCATGA	2 cut(s)	759, 796
Cfr13I	GGNCC	3 cut(s)	98, 186, 292
CpoI	CGGWCCG	1 cut(s)	292
CseI	GACGC	1 cut(s)	515
CsiI	ACCWGGT	1 cut(s)	66
Csp6I	GTAC	2 cut(s)	543, 549
CspI	CGGWCCG	1 cut(s)	292
CviAII	CATG	3 cut(s)	703, 760, 797
CviJI	RGCY	3 cut(s)	187, 346, 693
CviKI_1	RGCY	3 cut(s)	187, 346, 693
CviQI	GTAC	2 cut(s)	543, 549
DdeI	CTNAG	5 cut(s)	13, 164, 182, 335, 566
DpnI	GATC	3 cut(s)	395, 519, 639
DpnII	GATC	3 cut(s)	393, 517, 637
Eam1104I	CTCTTC	2 cut(s)	134, 146
EarI	CTCTTC	2 cut(s)	134, 146
EciI	GGCGGA	1 cut(s)	483
Eco47I	GGWCC	2 cut(s)	98, 292
Eco57I	CTGAAG	1 cut(s)	158
EcoRI	GAATTC	1 cut(s)	710
EcoRII	CCWGG	3 cut(s)	66, 100, 659
FaeI	CATG	3 cut(s)	706, 763, 800
FaiI	YATR	9 cut(s)	47, 84, 429, 563, 648, 656, 704, 761, 798
FalI	AAGNNNNNCTT	4 cut(s)	213, 245, 389, 421
FaqI	GGGAC	1 cut(s)	555
FatI	CATG	3 cut(s)	702, 759, 796
FauI	CCCGC	1 cut(s)	596
FbaI	TGATCA	1 cut(s)	393
Fnu4HI	GCNGC	1 cut(s)	784
FokI	GGATG	4 cut(s)	253, 397, 647, 692
Fsp4HI	GCNGC	1 cut(s)	784
FspBI	CTAG	1 cut(s)	546
GluI	GCNGC	1 cut(s)	784
HaeIII	GGCC	2 cut(s)	187, 693
HapII	CCGG	3 cut(s)	189, 290, 597
HgaI	GACGC	1 cut(s)	515
Hin1II	CATG	3 cut(s)	706, 763, 800
HinfI	GANTC	5 cut(s)	286, 368, 568, 588, 668
HpaII	CCGG	3 cut(s)	189, 290, 597
Hpy188I	TCNGA	6 cut(s)	138, 183, 373, 593, 709, 776
Hpy188III	TCNNGA	8 cut(s)	59, 76, 196, 238, 290, 381, 760, 797
Hpy99I	CGWCG	1 cut(s)	531
HpyAV	CCTTC	1 cut(s)	276
HpyCH4III	ACNGT	1 cut(s)	98
HpyCH4V	TGCA	3 cut(s)	244, 509, 783
HpyF3I	CTNAG	5 cut(s)	13, 164, 182, 335, 566
Hsp92II	CATG	3 cut(s)	706, 763, 800
Kpn2I	TCCGGA	1 cut(s)	289
Ksp22I	TGATCA	1 cut(s)	393
Kzo9I	GATC	3 cut(s)	393, 517, 637
Lsp1109I	GCAGC	1 cut(s)	795
LweI	GCATC	1 cut(s)	231
MabI	ACCWGGT	1 cut(s)	66
MaeI	CTAG	1 cut(s)	546
MalI	GATC	3 cut(s)	395, 519, 639
MboI	GATC	3 cut(s)	393, 517, 637
MluCI	AATT	5 cut(s)	175, 643, 710, 763, 811
MlyI	GAGTC	2 cut(s)	577, 597
MmeI	TCCRAC	2 cut(s)	571, 754
MroI	TCCGGA	1 cut(s)	289
MseI	TTAA	4 cut(s)	173, 504, 792, 823
MspI	CCGG	3 cut(s)	189, 290, 597
MspR9I	CCNGG	4 cut(s)	68, 102, 189, 661
MvaI	CCWGG	3 cut(s)	68, 102, 661
MvnI	CGCG	1 cut(s)	60
NciI	CCSGG	1 cut(s)	189
NdeII	GATC	3 cut(s)	393, 517, 637
NlaIII	CATG	3 cut(s)	706, 763, 800
NlaIV	GGNNCC	1 cut(s)	595
NruI	TCGCGA	1 cut(s)	60
NspI	RCATGY	1 cut(s)	706
NspV	TTCGAA	2 cut(s)	21, 731
PagI	TCATGA	2 cut(s)	759, 796
PciI	ACATGT	1 cut(s)	702
PfeI	GAWTC	3 cut(s)	286, 368, 668
PkrI	GCNGC	1 cut(s)	785
PleI	GAGTC	2 cut(s)	576, 596
PpsI	GAGTC	2 cut(s)	576, 596
PscI	ACATGT	1 cut(s)	702
PshAI	GACNNNNGTC	1 cut(s)	429
PsiI	TTATAA	1 cut(s)	648
Psp6I	CCWGG	3 cut(s)	66, 100, 659
PspGI	CCWGG	3 cut(s)	66, 100, 659
PspN4I	GGNNCC	1 cut(s)	595
PspPI	GGNCC	3 cut(s)	98, 186, 292
RruI	TCGCGA	1 cut(s)	60
RsaI	GTAC	2 cut(s)	544, 550
RsaNI	GTAC	2 cut(s)	543, 549
Rsr2I	CGGWCCG	1 cut(s)	292
RsrII	CGGWCCG	1 cut(s)	292
SaqAI	TTAA	4 cut(s)	173, 504, 792, 823
SatI	GCNGC	1 cut(s)	784
Sau3AI	GATC	3 cut(s)	393, 517, 637
Sau96I	GGNCC	3 cut(s)	98, 186, 292
SchI	GAGTC	2 cut(s)	577, 597
ScrFI	CCNGG	4 cut(s)	68, 102, 189, 661
SexAI	ACCWGGT	1 cut(s)	66
SfaNI	GCATC	1 cut(s)	231
SfuI	TTCGAA	2 cut(s)	21, 731
SinI	GGWCC	2 cut(s)	98, 292
SmlI	CTYRAG	1 cut(s)	74
SmoI	CTYRAG	1 cut(s)	74
SpeI	ACTAGT	1 cut(s)	545
Sse9I	AATT	5 cut(s)	175, 643, 710, 763, 811
SsiI	CCGC	3 cut(s)	468, 540, 603
SspMI	CTAG	1 cut(s)	546
StyD4I	CCNGG	4 cut(s)	66, 100, 187, 659
TaaI	ACNGT	1 cut(s)	98
TaqI	TCGA	5 cut(s)	21, 380, 621, 671, 731
TaqII	GACCGA	1 cut(s)	309
TasI	AATT	5 cut(s)	175, 643, 710, 763, 811
TfiI	GAWTC	3 cut(s)	286, 368, 668
Tru1I	TTAA	4 cut(s)	173, 504, 792, 823
Tru9I	TTAA	4 cut(s)	173, 504, 792, 823
TseI	GCWGC	1 cut(s)	783
TspDTI	ATGAA	3 cut(s)	234, 748, 776
TspGWI	ACGGA	1 cut(s)	380
VpaK11BI	GGWCC	2 cut(s)	98, 292
XapI	RAATTY	2 cut(s)	710, 763
XceI	RCATGY	1 cut(s)	706
XcmI	CCANNNNNNNNNTGG	1 cut(s)	580
XspI	CTAG	1 cut(s)	546

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.