Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0033032.1

Orthogroup ID

OG0002840

Physical Location & Seq

Genomic Coordinates Reverse (-)

1281 .. 4975

Gene Structure 3695 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0033032.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 465 bp

atgggagactcgcactccctagcagagctggagcgaatccaaacccaaatcctccaacgcatttctagcctcgagatctcctccgcctctctaccattgttctgtgaccgcaacaactcaaagtattatcttgtggtagttcagtatactgctcggtttaatgccgaagctgttaagaacttcttgtataccctcaacgaaggcaaaatcgccaaaaagaagttcaacttgaggcttgcacctgaggagacttcaacacaattgactgggtttgagcacaatgcggttacatgtgttggcatgaaaacagaaattccggtgattttggatgaagcaattcaaaaacttaatcccgatttcttctggttgggtggcggagaggttgatctgaagctgggcatcaaaacctcggagttcataaatgttgttaaaccttttattgtgagctgtagtaatagcacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

tRNA_edit

Protein Analysis

154

Amino Acids

17.24

Weight (kDa)

6.13

Isoelectric Point (pI)

26.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002840)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G16510 AT4G16510
fragaria_vesca	FvH4_2g25460 FvH4_3g26313 FvH4_5g00080 FvH4_5g00080 FvH4_5g00080 FvH4_5g00080 FvH4_5g00080 FvH4_5g00080 FvH4_5g26851 FvH4_5g38900 FvH4_6g19840 FvH4_6g26281 FvH4_7g10800
malus_domestica	MD00G1115100.v1.1 MD06G1061300.v1.1
prunus_persica	Prupe.5G072600_v2.0.a1
pyrus_communis	pycom06g05140
rosa_chinensis	RchiOBHm_Chr1g0333271 RchiOBHm_Chr2g0095921 RchiOBHm_Chr2g0099411 RchiOBHm_Chr7g0202881 RchiOBHm_Chr7g0233531
rosa_laevigata	RLG00000003567 RLG00000033632
rosa_multiflora	Rmu_sc0003729.1_g000007 Rmu_sc0033032.1_g000002
rosa_roxburghii	Rroxscaffold_1G00038270 Rroxscaffold_2G00110700 Rroxscaffold_3G00254210
rosa_rugosa	Rorug07G0073500
rosa_samantha	Rh2DG104700 Rh2DG133400 Rh7AG201300 Rh7BG201700 Rh7CG212800 Rh7DG208300
rosa_wichuraiana	Rw7G017610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	2 cut(s)	146, 188
AciI	CCGC	4 cut(s)	84, 109, 284, 375
AcsI	RAATTY	1 cut(s)	312
AcuI	CTGAAG	1 cut(s)	410
AflIII	ACRYGT	1 cut(s)	290
AgsI	TTSAA	3 cut(s)	226, 255, 341
AjuI	GAANNNNNNNTTGG	2 cut(s)	206, 238
AluBI	AGCT	4 cut(s)	28, 170, 394, 447
AluI	AGCT	4 cut(s)	28, 170, 394, 447
Alw21I	GWGCWC	1 cut(s)	279
Alw26I	GTCTC	1 cut(s)	242
Ama87I	CYCGRG	1 cut(s)	71
ApoI	RAATTY	1 cut(s)	312
Asp700I	GAANNNNTTC	1 cut(s)	336
AsuHPI	GGTGA	1 cut(s)	331
AvaI	CYCGRG	1 cut(s)	71
AxyI	CCTNAGG	1 cut(s)	243
Bbv12I	GWGCWC	1 cut(s)	279
BcoDI	GTCTC	1 cut(s)	242
BfaI	CTAG	2 cut(s)	20, 66
BfmI	CTRYAG	1 cut(s)	448
BglII	AGATCT	1 cut(s)	75
BmeT110I	CYCGRG	1 cut(s)	71
BmrI	ACTGGG	1 cut(s)	276
BmsI	GCATC	1 cut(s)	408
BmuI	ACTGGG	1 cut(s)	276
BplI	GAGNNNNNCTC	2 cut(s)	65, 97
BpmI	CTGGAG	1 cut(s)	50
BpuEI	CTTGAG	1 cut(s)	250
BsaJI	CCNNGG	1 cut(s)	408
BsaWI	WCCGGW	1 cut(s)	316
BsaXI	ACNNNNNCTCC	1 cut(s)	29
Bse1I	ACTGG	1 cut(s)	271
Bse21I	CCTNAGG	1 cut(s)	243
BseDI	CCNNGG	1 cut(s)	408
BseGI	GGATG	1 cut(s)	334
BseMII	CTCAG	1 cut(s)	234
BseNI	ACTGG	1 cut(s)	271
BseRI	GAGGAG	2 cut(s)	70, 260
BseYI	CCCAGC	1 cut(s)	394
BsiHKAI	GWGCWC	1 cut(s)	279
BsiHKCI	CYCGRG	1 cut(s)	71
BsiSI	CCGG	1 cut(s)	317
BsmAI	GTCTC	1 cut(s)	242
BsoBI	CYCGRG	1 cut(s)	71
Bsp1286I	GDGCHC	1 cut(s)	279
Bsp143I	GATC	2 cut(s)	75, 385
BspACI	CCGC	4 cut(s)	84, 109, 284, 375
BspCNI	CTCAG	1 cut(s)	235
BsrI	ACTGG	1 cut(s)	271
BssECI	CCNNGG	1 cut(s)	408
BssMI	GATC	2 cut(s)	75, 385
BssNAI	GTATAC	2 cut(s)	147, 189
Bst1107I	GTATAC	2 cut(s)	147, 189
BstC8I	GCNNGC	1 cut(s)	237
BstDEI	CTNAG	1 cut(s)	243
BstF5I	GGATG	1 cut(s)	334
BstKTI	GATC	2 cut(s)	78, 388
BstMAI	GTCTC	1 cut(s)	242
BstMBI	GATC	2 cut(s)	75, 385
BstMWI	GCNNNNNNNGC	1 cut(s)	66
BstNSI	RCATGY	1 cut(s)	294
BstSFI	CTRYAG	1 cut(s)	448
BstX2I	RGATCY	1 cut(s)	75
BstYI	RGATCY	1 cut(s)	75
BstZ17I	GTATAC	2 cut(s)	147, 189
Bsu36I	CCTNAGG	1 cut(s)	243
BtsCI	GGATG	1 cut(s)	334
Cac8I	GCNNGC	1 cut(s)	237
CviAII	CATG	2 cut(s)	291, 301
CviJI	RGCY	6 cut(s)	28, 69, 170, 235, 394, 447
CviKI_1	RGCY	6 cut(s)	28, 69, 170, 235, 394, 447
DdeI	CTNAG	1 cut(s)	243
DpnI	GATC	2 cut(s)	77, 387
DpnII	GATC	2 cut(s)	75, 385
EciI	GGCGGA	2 cut(s)	73, 390
Eco57I	CTGAAG	1 cut(s)	410
Eco81I	CCTNAGG	1 cut(s)	243
Eco88I	CYCGRG	1 cut(s)	71
FaeI	CATG	2 cut(s)	294, 304
FaiI	YATR	5 cut(s)	147, 189, 292, 302, 419
FalI	AAGNNNNNCTT	4 cut(s)	167, 199, 212, 244
FatI	CATG	2 cut(s)	290, 300
FblI	GTMKAC	2 cut(s)	146, 188
FokI	GGATG	1 cut(s)	341
FspBI	CTAG	2 cut(s)	20, 66
GsaI	CCCAGC	1 cut(s)	398
GsuI	CTGGAG	1 cut(s)	50
HapII	CCGG	1 cut(s)	317
Hin1II	CATG	2 cut(s)	294, 304
HinfI	GANTC	2 cut(s)	8, 36
HpaII	CCGG	1 cut(s)	317
HphI	GGTGA	1 cut(s)	331
Hpy166II	GTNNAC	2 cut(s)	147, 189
Hpy188I	TCNGA	2 cut(s)	390, 412
Hpy188III	TCNNGA	2 cut(s)	73, 353
Hpy8I	GTNNAC	2 cut(s)	147, 189
HpyAV	CCTTC	1 cut(s)	194
HpyCH4V	TGCA	1 cut(s)	239
HpyF10VI	GCNNNNNNNGC	1 cut(s)	66
HpyF3I	CTNAG	1 cut(s)	243
Hsp92II	CATG	2 cut(s)	294, 304
Kzo9I	GATC	2 cut(s)	75, 385
LmnI	GCTCC	1 cut(s)	31
LpnPI	CCDG	6 cut(s)	14, 252, 255, 330, 349, 380
LweI	GCATC	1 cut(s)	408
MaeI	CTAG	2 cut(s)	20, 66
MaeIII	GTNAC	2 cut(s)	104, 286
MalI	GATC	2 cut(s)	77, 387
MboI	GATC	2 cut(s)	75, 385
MboII	GAAGA	1 cut(s)	352
MfeI	CAATTG	1 cut(s)	260
MflI	RGATCY	1 cut(s)	75
MhlI	GDGCHC	1 cut(s)	279
MluCI	AATT	3 cut(s)	260, 312, 336
MlyI	GAGTC	1 cut(s)	2
MmeI	TCCRAC	1 cut(s)	79
MnlI	CCTC	9 cut(s)	62, 80, 91, 97, 203, 225, 238, 373, 418
MroXI	GAANNNNTTC	1 cut(s)	336
MseI	TTAA	4 cut(s)	159, 174, 348, 429
MspI	CCGG	1 cut(s)	317
MunI	CAATTG	1 cut(s)	260
MwoI	GCNNNNNNNGC	1 cut(s)	66
NdeII	GATC	2 cut(s)	75, 385
NlaIII	CATG	2 cut(s)	294, 304
NmuCI	GTSAC	1 cut(s)	104
NspI	RCATGY	1 cut(s)	294
PaeR7I	CTCGAG	1 cut(s)	71
PciI	ACATGT	1 cut(s)	290
PdmI	GAANNNNTTC	1 cut(s)	336
PfeI	GAWTC	1 cut(s)	36
PleI	GAGTC	1 cut(s)	2
PpsI	GAGTC	1 cut(s)	2
PscI	ACATGT	1 cut(s)	290
PspFI	CCCAGC	1 cut(s)	394
PsuI	RGATCY	1 cut(s)	75
SaqAI	TTAA	4 cut(s)	159, 174, 348, 429
Sau3AI	GATC	2 cut(s)	75, 385
SchI	GAGTC	1 cut(s)	2
SduI	GDGCHC	1 cut(s)	279
SetI	ASST	8 cut(s)	30, 172, 244, 384, 396, 410, 436, 449
SfaNI	GCATC	1 cut(s)	408
SfcI	CTRYAG	1 cut(s)	448
Sfr274I	CTCGAG	1 cut(s)	71
SlaI	CTCGAG	1 cut(s)	71
SmlI	CTYRAG	2 cut(s)	71, 229
SmoI	CTYRAG	2 cut(s)	71, 229
Sse9I	AATT	3 cut(s)	260, 312, 336
SsiI	CCGC	4 cut(s)	84, 109, 284, 375
SspMI	CTAG	2 cut(s)	20, 66
TaqI	TCGA	1 cut(s)	72
TasI	AATT	3 cut(s)	260, 312, 336
TfiI	GAWTC	1 cut(s)	36
Tru1I	TTAA	4 cut(s)	159, 174, 348, 429
Tru9I	TTAA	4 cut(s)	159, 174, 348, 429
TseFI	GTSAC	1 cut(s)	104
Tsp45I	GTSAC	1 cut(s)	104
TspDTI	ATGAA	3 cut(s)	317, 345, 406
XapI	RAATTY	1 cut(s)	312
XceI	RCATGY	1 cut(s)	294
XhoI	CTCGAG	1 cut(s)	71
XmiI	GTMKAC	2 cut(s)	146, 188
XmnI	GAANNNNTTC	1 cut(s)	336
XspI	CTAG	2 cut(s)	20, 66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.