Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000255.1

Orthogroup ID

OG0001892

Physical Location & Seq

Genomic Coordinates Reverse (-)

214047 .. 216307

Gene Structure 2261 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000255.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 897 bp

atgaagtacgacaaacccacagtttgtgttcttgatgcttcaacctacgttggcttttggattctcaaaggattacttgctcgaggcttcagagttcacgcagctacccagaagaatggggaaacagagattcagaagagaattagggaaatggagaaagaagaagagagattagtagttttctctgttgatgttttggattatcatagcattcttttggctttgaaaggttgctctgctgtgttctgttgtctagacagtccagaagcatacgatgaaaaaatggtgaatttggaggtgagaggagcaatcaatgttgttgaagcatgtgctcagacagacagcgtggagaagattttgttctcttcttcattggctgcagcaatatggaaggaggacatttcttctgagaaggatgtggatgaaaagtcatggagtgatccagaattctgcaggaaattgaagttgtggtatgccttagcaaagacacaatcggaacaggctgcttgggctctatcaatggaccggactcttaagatggtctctataaattctggactagtccttgggcctagtgtcacacaacaaaatccgcaaacaaccatgtcatatcttaacggagctgctcaaatgtatgaaaatggtgtactagcatttgtcgacgtggactttcttgtaaatgttcatattcgagctctagaggaccagtctgcttgcgggagatatttctgctttagtcacatagtgaatactgaggacgaagctgttaagcttgcacagagcttgagtcctttaatatctttaccaccaaggtatcattacgaagggagtgaggcacatatcgagcgattgaggactaagaagttgagcaagctggttgagggagctgcctattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00940 ko01100 ko01110 map00940 map01100 map01110

Pfam Domains

Protein Families

3Beta_HSD Epimerase NAD_binding_10

Protein Analysis

298

Amino Acids

33.42

Weight (kDa)

5.39

Isoelectric Point (pI)

42.66

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001892)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G23910 AT2G23910 AT2G23910 AT2G23910 AT4G30470
fragaria_vesca	FvH4_5g22420 FvH4_5g22420 FvH4_5g22420
malus_domestica	MD00G1072500.v1.1 MD01G1237600.v1.1 MD06G1036600.v1.1 MD07G1310200.v1.1
prunus_persica	Prupe.1G099500_v2.0.a1 Prupe.1G099500_v2.0.a1 Prupe.1G099500_v2.0.a1 Prupe.1G099500_v2.0.a1 Prupe.5G032800_v2.0.a1
pyrus_communis	pycom01g24530 pycom06g03000 pycom13g28670
rosa_chinensis	RchiOBHm_Chr4g0405161 RchiOBHm_Chr7g0210161
rosa_laevigata	RLG00000003059 RLG00000008867
rosa_multiflora	Rmu_sc0005438.1_g000001 Rmu_sc0006908.1_g000015 Rmu_ssc0000255.1_g000034
rosa_roxburghii	Rroxscaffold_3G00248570 Rroxscaffold_5G00349400
rosa_rugosa	Rorug04G0054400 Rorug04G0054500 Rorug04G0054600 Rorug07G0119000
rosa_samantha	Rh1AG349400 Rh4AG129400 Rh4BG123100 Rh4CG136700 Rh4DG122900 Rh7AG252500 Rh7BG247600 Rh7CG269500 Rh7DG260100
rosa_wichuraiana	Rw0G002460 Rw1G031120 Rw4G010450 Rw7G021460

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	660
AciI	CCGC	2 cut(s)	593, 717
AclWI	GGATC	1 cut(s)	434
AcsI	RAATTY	3 cut(s)	289, 446, 550
AcuI	CTGAAG	1 cut(s)	73
AdeI	CACNNNGTG	1 cut(s)	745
AfaI	GTAC	2 cut(s)	8, 648
AflII	CTTAAG	1 cut(s)	533
AgsI	TTSAA	4 cut(s)	42, 226, 323, 463
AhlI	ACTAGT	1 cut(s)	559
AjiI	CACGTC	1 cut(s)	664
AluBI	AGCT	8 cut(s)	104, 623, 695, 764, 772, 783, 874, 887
AluI	AGCT	8 cut(s)	104, 623, 695, 764, 772, 783, 874, 887
Alw21I	GWGCWC	2 cut(s)	334, 697
Alw26I	GTCTC	1 cut(s)	547
AlwI	GGATC	1 cut(s)	434
Ama87I	CYCGRG	1 cut(s)	81
AoxI	GGCC	1 cut(s)	569
ApeKI	GCWGC	6 cut(s)	101, 377, 380, 503, 623, 887
ApoI	RAATTY	3 cut(s)	289, 446, 550
AspS9I	GGNCC	3 cut(s)	523, 569, 703
AsuHPI	GGTGA	2 cut(s)	298, 310
AvaI	CYCGRG	1 cut(s)	81
AvaII	GGWCC	2 cut(s)	523, 703
BaeI	ACNNNNGTAYC	2 cut(s)	797, 830
BanII	GRGCYC	2 cut(s)	514, 697
Bbv12I	GWGCWC	2 cut(s)	334, 697
BbvI	GCAGC	6 cut(s)	113, 364, 392, 490, 610, 874
BccI	CCATC	1 cut(s)	532
BcoDI	GTCTC	1 cut(s)	547
BcuI	ACTAGT	1 cut(s)	559
BfaI	CTAG	5 cut(s)	254, 560, 573, 650, 698
BfmI	CTRYAG	2 cut(s)	378, 451
BfrI	CTTAAG	1 cut(s)	533
BisI	GCNGC	6 cut(s)	102, 378, 381, 504, 624, 888
BlsI	GCNGC	6 cut(s)	103, 379, 382, 505, 625, 889
Bme18I	GGWCC	2 cut(s)	523, 703
BmeT110I	CYCGRG	1 cut(s)	81
BmgBI	CACGTC	1 cut(s)	664
BmgT120I	GGNCC	3 cut(s)	523, 569, 703
BmsI	GCATC	1 cut(s)	25
Bpu10I	CCTNAGC	1 cut(s)	478
BpuEI	CTTGAG	1 cut(s)	805
BsaI	GGTCTC	1 cut(s)	547
BsaJI	CCNNGG	2 cut(s)	565, 809
BsaWI	WCCGGW	1 cut(s)	525
Bse1I	ACTGG	1 cut(s)	706
BseDI	CCNNGG	2 cut(s)	565, 809
BseGI	GGATG	2 cut(s)	421, 427
BseMII	CTCAG	3 cut(s)	347, 399, 744
BseNI	ACTGG	1 cut(s)	706
BseRI	GAGGAG	1 cut(s)	318
BseXI	GCAGC	6 cut(s)	113, 364, 392, 490, 610, 874
BshFI	GGCC	1 cut(s)	571
BsiHKAI	GWGCWC	2 cut(s)	334, 697
BsiHKCI	CYCGRG	1 cut(s)	81
BsiSI	CCGG	1 cut(s)	526
BsmAI	GTCTC	1 cut(s)	547
BsmI	GAATGC	1 cut(s)	210
BsnI	GGCC	1 cut(s)	571
Bso31I	GGTCTC	1 cut(s)	547
BsoBI	CYCGRG	1 cut(s)	81
Bsp1286I	GDGCHC	3 cut(s)	334, 514, 697
Bsp143I	GATC	1 cut(s)	439
BspACI	CCGC	2 cut(s)	593, 717
BspANI	GGCC	1 cut(s)	571
BspCNI	CTCAG	3 cut(s)	346, 400, 745
BspMAI	CTGCAG	2 cut(s)	382, 455
BspPI	GGATC	1 cut(s)	434
BspTI	CTTAAG	1 cut(s)	533
BspTNI	GGTCTC	1 cut(s)	547
BsrI	ACTGG	1 cut(s)	706
BssECI	CCNNGG	2 cut(s)	565, 809
BssMI	GATC	1 cut(s)	439
BssT1I	CCWWGG	2 cut(s)	565, 809
Bst4CI	ACNGT	2 cut(s)	22, 260
Bst6I	CTCTTC	3 cut(s)	131, 159, 370
BstAFI	CTTAAG	1 cut(s)	533
BstC8I	GCNNGC	3 cut(s)	715, 774, 872
BstDEI	CTNAG	5 cut(s)	333, 408, 478, 753, 858
BstF5I	GGATG	2 cut(s)	421, 427
BstKTI	GATC	1 cut(s)	442
BstMAI	GTCTC	1 cut(s)	547
BstMBI	GATC	1 cut(s)	439
BstMWI	GCNNNNNNNGC	1 cut(s)	509
BstNSI	RCATGY	1 cut(s)	330
BstSFI	CTRYAG	2 cut(s)	378, 451
BstV1I	GCAGC	6 cut(s)	113, 364, 392, 490, 610, 874
BstXI	CCANNNNNNTGG	1 cut(s)	116
BsuRI	GGCC	1 cut(s)	571
BtrI	CACGTC	1 cut(s)	664
BtsCI	GGATG	2 cut(s)	421, 427
Cac8I	GCNNGC	3 cut(s)	715, 774, 872
Cfr13I	GGNCC	3 cut(s)	523, 569, 703
Csp6I	GTAC	2 cut(s)	7, 647
CviAII	CATG	3 cut(s)	327, 432, 604
CviQI	GTAC	2 cut(s)	7, 647
DdeI	CTNAG	5 cut(s)	333, 408, 478, 753, 858
DpnI	GATC	1 cut(s)	441
DpnII	GATC	1 cut(s)	439
DraIII	CACNNNGTG	1 cut(s)	745
Eam1104I	CTCTTC	3 cut(s)	131, 159, 370
EarI	CTCTTC	3 cut(s)	131, 159, 370
Ecl136II	GAGCTC	1 cut(s)	695
Eco130I	CCWWGG	2 cut(s)	565, 809
Eco24I	GRGCYC	2 cut(s)	514, 697
Eco31I	GGTCTC	1 cut(s)	547
Eco47I	GGWCC	2 cut(s)	523, 703
Eco53kI	GAGCTC	1 cut(s)	695
Eco57I	CTGAAG	1 cut(s)	73
Eco88I	CYCGRG	1 cut(s)	81
EcoICRI	GAGCTC	1 cut(s)	695
EcoRI	GAATTC	1 cut(s)	446
EcoT14I	CCWWGG	2 cut(s)	565, 809
EcoT38I	GRGCYC	2 cut(s)	514, 697
ErhI	CCWWGG	2 cut(s)	565, 809
FaeI	CATG	3 cut(s)	330, 435, 607
FalI	AAGNNNNNCTT	2 cut(s)	60, 92
FatI	CATG	3 cut(s)	326, 431, 603
FauI	CCCGC	1 cut(s)	710
FblI	GTMKAC	1 cut(s)	660
Fnu4HI	GCNGC	6 cut(s)	102, 378, 381, 504, 624, 888
FokI	GGATG	2 cut(s)	428, 434
FriOI	GRGCYC	2 cut(s)	514, 697
Fsp4HI	GCNGC	6 cut(s)	102, 378, 381, 504, 624, 888
FspBI	CTAG	5 cut(s)	254, 560, 573, 650, 698
GluI	GCNGC	6 cut(s)	102, 378, 381, 504, 624, 888
HaeIII	GGCC	1 cut(s)	571
HapII	CCGG	1 cut(s)	526
Hin1II	CATG	3 cut(s)	330, 435, 607
HincII	GTYRAC	1 cut(s)	661
HindII	GTYRAC	1 cut(s)	661
HindIII	AAGCTT	1 cut(s)	770
HinfI	GANTC	4 cut(s)	61, 130, 529, 787
HpaII	CCGG	1 cut(s)	526
HphI	GGTGA	2 cut(s)	298, 310
Hpy166II	GTNNAC	4 cut(s)	97, 647, 661, 667
Hpy188I	TCNGA	5 cut(s)	92, 135, 336, 409, 496
Hpy188III	TCNNGA	6 cut(s)	32, 254, 263, 443, 555, 698
Hpy8I	GTNNAC	4 cut(s)	97, 647, 661, 667
Hpy99I	CGWCG	1 cut(s)	665
HpyAV	CCTTC	3 cut(s)	385, 406, 818
HpyCH4III	ACNGT	2 cut(s)	22, 260
HpyCH4IV	ACGT	2 cut(s)	48, 663
HpyCH4V	TGCA	3 cut(s)	380, 453, 776
HpyF10VI	GCNNNNNNNGC	1 cut(s)	509
HpyF3I	CTNAG	5 cut(s)	333, 408, 478, 753, 858
HpySE526I	ACGT	2 cut(s)	48, 663
Hsp92II	CATG	3 cut(s)	330, 435, 607
Kzo9I	GATC	1 cut(s)	439
LmnI	GCTCC	3 cut(s)	305, 620, 884
LpnPI	CCDG	9 cut(s)	122, 276, 439, 456, 485, 539, 540, 719, 860
Lsp1109I	GCAGC	6 cut(s)	113, 364, 392, 490, 610, 874
LweI	GCATC	1 cut(s)	25
MaeI	CTAG	5 cut(s)	254, 560, 573, 650, 698
MaeII	ACGT	2 cut(s)	48, 663
MaeIII	GTNAC	2 cut(s)	577, 737
MalI	GATC	1 cut(s)	441
MboI	GATC	1 cut(s)	439
MboII	GAAGA	8 cut(s)	124, 148, 173, 176, 357, 360, 364, 396
MhlI	GDGCHC	3 cut(s)	334, 514, 697
MluCI	AATT	5 cut(s)	141, 289, 446, 458, 550
MlyI	GAGTC	2 cut(s)	523, 796
MnlI	CCTC	9 cut(s)	77, 289, 296, 388, 694, 748, 826, 846, 874
MseI	TTAA	4 cut(s)	534, 615, 768, 794
MspCI	CTTAAG	1 cut(s)	533
MspI	CCGG	1 cut(s)	526
Mva1269I	GAATGC	1 cut(s)	210
MwoI	GCNNNNNNNGC	1 cut(s)	509
NdeII	GATC	1 cut(s)	439
NlaIII	CATG	3 cut(s)	330, 435, 607
NmuCI	GTSAC	2 cut(s)	577, 737
NspI	RCATGY	1 cut(s)	330
PaeR7I	CTCGAG	1 cut(s)	81
PctI	GAATGC	1 cut(s)	210
PfeI	GAWTC	2 cut(s)	61, 130
PkrI	GCNGC	6 cut(s)	103, 379, 382, 505, 625, 889
PleI	GAGTC	2 cut(s)	523, 795
PpsI	GAGTC	2 cut(s)	523, 795
Psp124BI	GAGCTC	1 cut(s)	697
PspPI	GGNCC	3 cut(s)	523, 569, 703
PspXI	VCTCGAGB	1 cut(s)	81
PstI	CTGCAG	2 cut(s)	382, 455
RsaI	GTAC	2 cut(s)	8, 648
RsaNI	GTAC	2 cut(s)	7, 647
SacI	GAGCTC	1 cut(s)	697
SalI	GTCGAC	1 cut(s)	659
SaqAI	TTAA	4 cut(s)	534, 615, 768, 794
SatI	GCNGC	6 cut(s)	102, 378, 381, 504, 624, 888
Sau3AI	GATC	1 cut(s)	439
Sau96I	GGNCC	3 cut(s)	523, 569, 703
SchI	GAGTC	2 cut(s)	523, 796
SduI	GDGCHC	3 cut(s)	334, 514, 697
SfaNI	GCATC	1 cut(s)	25
SfcI	CTRYAG	2 cut(s)	378, 451
Sfr274I	CTCGAG	1 cut(s)	81
SinI	GGWCC	2 cut(s)	523, 703
SlaI	CTCGAG	1 cut(s)	81
SmlI	CTYRAG	3 cut(s)	81, 533, 784
SmoI	CTYRAG	3 cut(s)	81, 533, 784
SpeI	ACTAGT	1 cut(s)	559
Sse9I	AATT	5 cut(s)	141, 289, 446, 458, 550
SsiI	CCGC	2 cut(s)	593, 717
SspMI	CTAG	5 cut(s)	254, 560, 573, 650, 698
SstI	GAGCTC	1 cut(s)	697
StyI	CCWWGG	2 cut(s)	565, 809
TaaI	ACNGT	2 cut(s)	22, 260
TaiI	ACGT	2 cut(s)	51, 666
TaqI	TCGA	4 cut(s)	82, 660, 691, 843
TasI	AATT	5 cut(s)	141, 289, 446, 458, 550
TatI	WGTACW	1 cut(s)	646
TfiI	GAWTC	2 cut(s)	61, 130
Tru1I	TTAA	4 cut(s)	534, 615, 768, 794
Tru9I	TTAA	4 cut(s)	534, 615, 768, 794
TseFI	GTSAC	2 cut(s)	577, 737
TseI	GCWGC	6 cut(s)	101, 377, 380, 503, 623, 887
Tsp45I	GTSAC	2 cut(s)	577, 737
TspDTI	ATGAA	6 cut(s)	17, 291, 360, 438, 651, 674
TspGWI	ACGGA	1 cut(s)	633
Vha464I	CTTAAG	1 cut(s)	533
VpaK11BI	GGWCC	2 cut(s)	523, 703
XapI	RAATTY	3 cut(s)	289, 446, 550
XbaI	TCTAGA	2 cut(s)	253, 697
XceI	RCATGY	1 cut(s)	330
XhoI	CTCGAG	1 cut(s)	81
XmiI	GTMKAC	1 cut(s)	660
XspI	CTAG	5 cut(s)	254, 560, 573, 650, 698

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.