Rorug04G0054400

Cinnamoyl-CoA reductase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
8566912 .. 8569649
2738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0054400.1

Sequence Viewer

Length: 564 bp
ATGAATGTGATTTTCCCTTGGATAGCAATTACATTTGATCATGATGTTTCGGGTACACATCGCAAAAATGGGTTGGAGAACAAGCTTAGGTATAAGCCAAATGATCGCATTTCCACCACAAAGTTGGATATGGGGTTTAGTGATTTTACAGGAACATATGCTTTGAAGAAACCCGGTCAAAAATACAGACAAGTCCATTGTGTCTCCCCATCTATTGAGCCCATTCTAGAATATATAGCCTCTGCAATGTCAAGGTCCACTGCACAGAAGCTTCTGGCCGGATTGGTTTTGTCAGTTCCTTTTTGCATTGTAGTACAAGGGAGAAGCTTTGAAAGGGCCAAGAGACTTGTATGTGTGTGGGGCTTTCAATGGACAAACCCTCGAGGAATCAATTACAACCTAGAAAATTTGGTGGAGTTCAAAGCAACTCTTGAACAGAATTTTCTCAAGGGAACGAAAGATCCCAAGCTTGATGGAAATCTAAAGACACAAAGAGAAGAAGGGTCTTTGATCAGTGTCAAAGTCAAGTTCTTTTCTAAGCTAGCTGTAGGTAAAGCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

187

Amino Acids

21.16

Weight (kDa)

9.8

Isoelectric Point (pI)

20.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 381
AclWI GGATC 1 cut(s) 455
AcoI YGGCCR 1 cut(s) 276
AcsI RAATTY 2 cut(s) 406, 439
AfaI GTAC 2 cut(s) 55, 315
AgsI TTSAA 5 cut(s) 166, 332, 368, 421, 434
AloI GAACNNNNNNTCC 2 cut(s) 445, 477
AluBI AGCT 6 cut(s) 85, 271, 327, 469, 541, 545
AluI AGCT 6 cut(s) 85, 271, 327, 469, 541, 545
Alw26I GTCTC 2 cut(s) 208, 337
AlwI GGATC 1 cut(s) 455
Ama87I CYCGRG 1 cut(s) 381
AoxI GGCC 2 cut(s) 276, 336
ApoI RAATTY 2 cut(s) 406, 439
AspS9I GGNCC 2 cut(s) 255, 336
AsuC2I CCSGG 1 cut(s) 174
AsuNHI GCTAGC 1 cut(s) 541
AvaI CYCGRG 1 cut(s) 381
AvaII GGWCC 1 cut(s) 255
BanII GRGCYC 1 cut(s) 222
BccI CCATC 2 cut(s) 217, 467
BclI TGATCA 2 cut(s) 37, 510
BcnI CCSGG 1 cut(s) 174
BcoDI GTCTC 2 cut(s) 208, 337
BfaI CTAG 3 cut(s) 227, 401, 542
BfmI CTRYAG 1 cut(s) 546
Bme1390I CCNGG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 255
BmeT110I CYCGRG 1 cut(s) 381
BmgT120I GGNCC 2 cut(s) 255, 336
BmrFI CCNGG 1 cut(s) 174
BmtI GCTAGC 1 cut(s) 545
Bpu10I CCTNAGC 1 cut(s) 86
BpuEI CTTGAG 1 cut(s) 431
BpuMI CCSGG 1 cut(s) 174
BsaBI GATNNNNATC 1 cut(s) 477
BsaJI CCNNGG 1 cut(s) 17
Bse3DI GCAATG 1 cut(s) 252
Bse8I GATNNNNATC 1 cut(s) 477
BseDI CCNNGG 1 cut(s) 17
BseJI GATNNNNATC 1 cut(s) 477
BseMI GCAATG 1 cut(s) 252
BsgI GTGCAG 1 cut(s) 246
BshFI GGCC 2 cut(s) 278, 338
BsiHKCI CYCGRG 1 cut(s) 381
BsiSI CCGG 2 cut(s) 174, 279
BsmAI GTCTC 2 cut(s) 208, 337
BsnI GGCC 2 cut(s) 278, 338
BsoBI CYCGRG 1 cut(s) 381
Bsp1286I GDGCHC 1 cut(s) 222
Bsp143I GATC 4 cut(s) 37, 103, 460, 510
BspANI GGCC 2 cut(s) 278, 338
BspHI TCATGA 1 cut(s) 40
BspOI GCTAGC 1 cut(s) 545
BspPI GGATC 1 cut(s) 455
BsrDI GCAATG 1 cut(s) 252
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 4 cut(s) 37, 103, 460, 510
BssT1I CCWWGG 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 543
BstDEI CTNAG 2 cut(s) 86, 537
BstKTI GATC 4 cut(s) 40, 106, 463, 513
BstMAI GTCTC 2 cut(s) 208, 337
BstMBI GATC 4 cut(s) 37, 103, 460, 510
BstSCI CCNGG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 546
BstX2I RGATCY 1 cut(s) 460
BstXI CCANNNNNNTGG 1 cut(s) 124
BstYI RGATCY 1 cut(s) 460
BsuRI GGCC 2 cut(s) 278, 338
BtgZI GCGATG 1 cut(s) 44
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 2 cut(s) 258, 520
Cac8I GCNNGC 1 cut(s) 543
CciI TCATGA 1 cut(s) 40
Cfr13I GGNCC 2 cut(s) 255, 336
Csp6I GTAC 2 cut(s) 54, 314
CviAII CATG 1 cut(s) 41
CviQI GTAC 2 cut(s) 54, 314
DdeI CTNAG 2 cut(s) 86, 537
DpnI GATC 4 cut(s) 39, 105, 462, 512
DpnII GATC 4 cut(s) 37, 103, 460, 510
EaeI YGGCCR 1 cut(s) 276
Eco130I CCWWGG 1 cut(s) 17
Eco24I GRGCYC 1 cut(s) 222
Eco47I GGWCC 1 cut(s) 255
Eco88I CYCGRG 1 cut(s) 381
EcoT14I CCWWGG 1 cut(s) 17
EcoT38I GRGCYC 1 cut(s) 222
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 44
FaiI YATR 8 cut(s) 42, 93, 131, 157, 159, 234, 236, 352
FalI AAGNNNNNCTT 2 cut(s) 414, 446
FatI CATG 1 cut(s) 40
FauNDI CATATG 1 cut(s) 157
FbaI TGATCA 2 cut(s) 37, 510
FriOI GRGCYC 1 cut(s) 222
FspBI CTAG 3 cut(s) 227, 401, 542
HaeIII GGCC 2 cut(s) 278, 338
HapII CCGG 2 cut(s) 174, 279
Hin1II CATG 1 cut(s) 44
HindIII AAGCTT 4 cut(s) 83, 269, 325, 467
HinfI GANTC 1 cut(s) 387
HpaII CCGG 2 cut(s) 174, 279
Hpy166II GTNNAC 2 cut(s) 56, 258
Hpy188III TCNNGA 3 cut(s) 41, 227, 431
Hpy8I GTNNAC 2 cut(s) 56, 258
HpyAV CCTTC 1 cut(s) 494
HpyCH4V TGCA 3 cut(s) 245, 263, 306
HpyF3I CTNAG 2 cut(s) 86, 537
Hsp92II CATG 1 cut(s) 44
Ksp22I TGATCA 2 cut(s) 37, 510
Kzo9I GATC 4 cut(s) 37, 103, 460, 510
LpnPI CCDG 4 cut(s) 135, 187, 260, 292
MaeI CTAG 3 cut(s) 227, 401, 542
MalI GATC 4 cut(s) 39, 105, 462, 512
MboI GATC 4 cut(s) 37, 103, 460, 510
MboII GAAGA 2 cut(s) 178, 509
MflI RGATCY 1 cut(s) 460
MhlI GDGCHC 1 cut(s) 222
MluCI AATT 4 cut(s) 27, 391, 406, 439
MmeI TCCRAC 2 cut(s) 54, 105
MnlI CCTC 3 cut(s) 250, 377, 390
MspI CCGG 2 cut(s) 174, 279
MspR9I CCNGG 1 cut(s) 174
NciI CCSGG 1 cut(s) 174
NdeI CATATG 1 cut(s) 157
NdeII GATC 4 cut(s) 37, 103, 460, 510
NheI GCTAGC 1 cut(s) 541
NlaIII CATG 1 cut(s) 44
PaeR7I CTCGAG 1 cut(s) 381
PagI TCATGA 1 cut(s) 40
PfeI GAWTC 1 cut(s) 387
PspPI GGNCC 2 cut(s) 255, 336
PspXI VCTCGAGB 1 cut(s) 381
PsuI RGATCY 1 cut(s) 460
RsaI GTAC 2 cut(s) 55, 315
RsaNI GTAC 2 cut(s) 54, 314
Sau3AI GATC 4 cut(s) 37, 103, 460, 510
Sau96I GGNCC 2 cut(s) 255, 336
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 222
SfcI CTRYAG 1 cut(s) 546
Sfr274I CTCGAG 1 cut(s) 381
SinI GGWCC 1 cut(s) 255
SlaI CTCGAG 1 cut(s) 381
SmlI CTYRAG 2 cut(s) 381, 446
SmoI CTYRAG 2 cut(s) 381, 446
Sse9I AATT 4 cut(s) 27, 391, 406, 439
SspMI CTAG 3 cut(s) 227, 401, 542
StyD4I CCNGG 1 cut(s) 172
StyI CCWWGG 1 cut(s) 17
TaqI TCGA 1 cut(s) 382
TasI AATT 4 cut(s) 27, 391, 406, 439
TatI WGTACW 1 cut(s) 313
TfiI GAWTC 1 cut(s) 387
TscAI CASTG 2 cut(s) 265, 520
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 265, 520
VpaK11BI GGWCC 1 cut(s) 255
XapI RAATTY 2 cut(s) 406, 439
XbaI TCTAGA 1 cut(s) 226
XcmI CCANNNNNNNNNTGG 1 cut(s) 121
XhoI CTCGAG 1 cut(s) 381
XspI CTAG 3 cut(s) 227, 401, 542
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.