Rroxscaffold_1G00042710

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
61033834 .. 61042526
8693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00042710.1

Sequence Viewer

Length: 771 bp
ATGTATTGGTTTTTGTTACCTGGAAGTATTCGGGGAGAAGGTTGGTTACCAATATGTGAAGACAAAGATGTGTTAGATATGTTGAAGTTTATGCCAAGTAATCGGATATTGCAGATTTACATTGTTGGGGGAGGTGTAAGAAAAAAAAAGGAAGCTGAGTTAGAGGATGAGGGTGGGGGTTCTCCTAAAGAAGTTGATCACCAAAAGTATATTGGCAATGTGGTAGAAGACTTGGAAGAAGTGATTGATGGTGATCTTGCTGTGACAACTTTACATGGGGCAAAGGTTTCAAGTAAGGCAAGTGGAAAGAGAAACAAGGGAGGTAGGCCAAAGAATAAGAAGGATGTGGTTACACACTTGACAAACCAGTTTATAAATGTCAAGGCTAGTGAGACAATTGCAGGTGATAATCTAGTGGCTGAAAATAGAAAGAGACCTAGAATGAAGCAAAAAGCATGCAAGATGAAGAAGAAATCGAGACCATATGAAACCAGATTTATGGGGGAAAAAAGTTTTGTCGAAGTAGAAGGCATTCAAGAAGAACTCGAAACATCCGATAATGATGATCCAAATTTTGAAGATCTAGTAGATAGTGACTACGACCTTGATGATAATGATGATGAGTTTCTGTTTAAGGCCAATATCGATGGTGACCCCGATGCTAGTCATGAGTTCAATGAAATGGGATTTGCGGGTGACATTTCGGATGGAGAAGGTGAAGATTCCGAGAAGTTTGATAGTGGAACCGATTCAACAAAGAATCGAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

256

Amino Acids

28.62

Weight (kDa)

4.72

Isoelectric Point (pI)

37.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 374
AarI CACCTGC 1 cut(s) 392
Acc36I ACCTGC 1 cut(s) 392
AciI CCGC 1 cut(s) 692
AclWI GGATC 1 cut(s) 560
AcsI RAATTY 1 cut(s) 571
AgsI TTSAA 6 cut(s) 85, 291, 536, 578, 676, 753
AjnI CCWGG 1 cut(s) 19
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
Alw26I GTCTC 3 cut(s) 386, 427, 472
AlwI GGATC 1 cut(s) 560
AoxI GGCC 2 cut(s) 326, 636
ApoI RAATTY 1 cut(s) 571
Asp700I GAANNNNTTC 2 cut(s) 531, 748
AsuHPI GGTGA 6 cut(s) 191, 263, 416, 662, 707, 728
BarI GAAGNNNNNNTAC 2 cut(s) 30, 62
BbsI GAAGAC 2 cut(s) 66, 234
BccI CCATC 3 cut(s) 242, 641, 701
BciT130I CCWGG 1 cut(s) 21
BclI TGATCA 1 cut(s) 196
BcoDI GTCTC 3 cut(s) 386, 427, 472
BfaI CTAG 5 cut(s) 387, 413, 438, 584, 663
BfuAI ACCTGC 1 cut(s) 392
BglII AGATCT 1 cut(s) 580
Bme1390I CCNGG 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 745
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 649
BpiI GAAGAC 2 cut(s) 66, 234
Bsa29I ATCGAT 1 cut(s) 645
BsaBI GATNNNNATC 1 cut(s) 252
BsaI GGTCTC 2 cut(s) 427, 472
Bse1I ACTGG 1 cut(s) 367
Bse3DI GCAATG 1 cut(s) 223
Bse8I GATNNNNATC 1 cut(s) 252
BseBI CCWGG 1 cut(s) 21
BseCI ATCGAT 1 cut(s) 645
BseGI GGATG 4 cut(s) 172, 349, 551, 712
BseJI GATNNNNATC 1 cut(s) 252
BseMI GCAATG 1 cut(s) 223
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 367
BshFI GGCC 2 cut(s) 328, 638
BshVI ATCGAT 1 cut(s) 645
BsmAI GTCTC 3 cut(s) 386, 427, 472
BsmI GAATGC 1 cut(s) 531
BsnI GGCC 2 cut(s) 328, 638
Bso31I GGTCTC 2 cut(s) 427, 472
Bsp143I GATC 4 cut(s) 196, 253, 565, 580
BspACI CCGC 1 cut(s) 692
BspANI GGCC 2 cut(s) 328, 638
BspCNI CTCAG 1 cut(s) 148
BspDI ATCGAT 1 cut(s) 645
BspHI TCATGA 1 cut(s) 667
BspLI GGNNCC 1 cut(s) 745
BspMI ACCTGC 1 cut(s) 392
BspPI GGATC 1 cut(s) 560
BspTNI GGTCTC 2 cut(s) 427, 472
BsrDI GCAATG 1 cut(s) 223
BsrI ACTGG 1 cut(s) 367
BssMI GATC 4 cut(s) 196, 253, 565, 580
Bst2UI CCWGG 1 cut(s) 21
BstC8I GCNNGC 1 cut(s) 457
BstDEI CTNAG 1 cut(s) 156
BstEII GGTNACC 2 cut(s) 45, 650
BstF5I GGATG 4 cut(s) 172, 349, 551, 712
BstKTI GATC 4 cut(s) 199, 256, 568, 583
BstMAI GTCTC 3 cut(s) 386, 427, 472
BstMBI GATC 4 cut(s) 196, 253, 565, 580
BstNI CCWGG 1 cut(s) 21
BstNSI RCATGY 1 cut(s) 459
BstPI GGTNACC 2 cut(s) 45, 650
BstSCI CCNGG 1 cut(s) 19
BstV2I GAAGAC 2 cut(s) 66, 234
BstX2I RGATCY 1 cut(s) 580
BstXI CCANNNNNNTGG 1 cut(s) 499
BstYI RGATCY 1 cut(s) 580
Bsu15I ATCGAT 1 cut(s) 645
BsuRI GGCC 2 cut(s) 328, 638
BsuTUI ATCGAT 1 cut(s) 645
BtsCI GGATG 4 cut(s) 172, 349, 551, 712
BveI ACCTGC 1 cut(s) 392
Cac8I GCNNGC 1 cut(s) 457
CciI TCATGA 1 cut(s) 667
ClaI ATCGAT 1 cut(s) 645
CviAII CATG 3 cut(s) 275, 456, 668
CviJI RGCY 5 cut(s) 155, 328, 386, 419, 638
CviKI_1 RGCY 5 cut(s) 155, 328, 386, 419, 638
DdeI CTNAG 1 cut(s) 156
DpnI GATC 4 cut(s) 198, 255, 567, 582
DpnII GATC 4 cut(s) 196, 253, 565, 580
Eco31I GGTCTC 2 cut(s) 427, 472
Eco91I GGTNACC 2 cut(s) 45, 650
EcoO65I GGTNACC 2 cut(s) 45, 650
EcoRII CCWGG 1 cut(s) 19
FaeI CATG 3 cut(s) 278, 459, 671
FatI CATG 3 cut(s) 274, 455, 667
FauI CCCGC 1 cut(s) 685
FauNDI CATATG 1 cut(s) 484
FbaI TGATCA 1 cut(s) 196
FokI GGATG 4 cut(s) 179, 356, 538, 719
FspBI CTAG 5 cut(s) 387, 413, 438, 584, 663
HaeIII GGCC 2 cut(s) 328, 638
Hin1II CATG 3 cut(s) 278, 459, 671
HinfI GANTC 3 cut(s) 722, 749, 760
HphI GGTGA 6 cut(s) 191, 263, 416, 662, 707, 728
Hpy188I TCNGA 4 cut(s) 105, 556, 706, 727
Hpy188III TCNNGA 3 cut(s) 477, 536, 668
HpyAV CCTTC 4 cut(s) 32, 334, 521, 707
HpyCH4V TGCA 3 cut(s) 112, 401, 459
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 3 cut(s) 278, 459, 671
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 4 cut(s) 196, 253, 565, 580
LpnPI CCDG 5 cut(s) 6, 33, 380, 387, 505
LweI GCATC 1 cut(s) 649
MaeI CTAG 5 cut(s) 387, 413, 438, 584, 663
MaeIII GTNAC 7 cut(s) 15, 45, 262, 349, 593, 650, 695
MalI GATC 4 cut(s) 198, 255, 567, 582
MboI GATC 4 cut(s) 196, 253, 565, 580
MboII GAAGA 8 cut(s) 71, 239, 248, 478, 481, 551, 590, 731
MfeI CAATTG 1 cut(s) 396
MflI RGATCY 1 cut(s) 580
MluCI AATT 2 cut(s) 396, 571
MnlI CCTC 5 cut(s) 125, 157, 163, 314, 758
MroXI GAANNNNTTC 2 cut(s) 531, 748
MseI TTAA 1 cut(s) 633
MspR9I CCNGG 1 cut(s) 21
MunI CAATTG 1 cut(s) 396
Mva1269I GAATGC 1 cut(s) 531
MvaI CCWGG 1 cut(s) 21
NdeI CATATG 1 cut(s) 484
NdeII GATC 4 cut(s) 196, 253, 565, 580
NlaIII CATG 3 cut(s) 278, 459, 671
NlaIV GGNNCC 1 cut(s) 745
NmuCI GTSAC 4 cut(s) 262, 593, 650, 695
NspI RCATGY 1 cut(s) 459
PaeI GCATGC 1 cut(s) 459
PagI TCATGA 1 cut(s) 667
PaqCI CACCTGC 1 cut(s) 392
PcsI WCGNNNNNNNCGW 1 cut(s) 552
PctI GAATGC 1 cut(s) 531
PdmI GAANNNNTTC 2 cut(s) 531, 748
PfeI GAWTC 3 cut(s) 722, 749, 760
PsiI TTATAA 1 cut(s) 374
Psp6I CCWGG 1 cut(s) 19
PspEI GGTNACC 2 cut(s) 45, 650
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 745
PsuI RGATCY 1 cut(s) 580
SaqAI TTAA 1 cut(s) 633
Sau3AI GATC 4 cut(s) 196, 253, 565, 580
ScrFI CCNGG 1 cut(s) 21
SfaNI GCATC 1 cut(s) 649
SphI GCATGC 1 cut(s) 459
Sse9I AATT 2 cut(s) 396, 571
SsiI CCGC 1 cut(s) 692
SspMI CTAG 5 cut(s) 387, 413, 438, 584, 663
StyD4I CCNGG 1 cut(s) 19
TaqI TCGA 5 cut(s) 476, 519, 546, 645, 763
TasI AATT 2 cut(s) 396, 571
TfiI GAWTC 3 cut(s) 722, 749, 760
Tru1I TTAA 1 cut(s) 633
Tru9I TTAA 1 cut(s) 633
TseFI GTSAC 4 cut(s) 262, 593, 650, 695
Tsp45I GTSAC 4 cut(s) 262, 593, 650, 695
TspDTI ATGAA 4 cut(s) 458, 479, 501, 693
XapI RAATTY 1 cut(s) 571
XceI RCATGY 1 cut(s) 459
XcmI CCANNNNNNNNNTGG 1 cut(s) 209
XmnI GAANNNNTTC 2 cut(s) 531, 748
XspI CTAG 5 cut(s) 387, 413, 438, 584, 663
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.