Rh2AG195800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
19569740 .. 19570232
493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG195800.1

Sequence Viewer

Length: 402 bp
ATGCAGGTTGAAGCTCAAAATGTTAACCAAGTTGATAATTCTGATAATGTTCTAAATTCTGCAAATCATGTGGCAAACGAGAATGGCATGCCATATGAAAATGTTGATGTTGATGCTATGATGCAGGAGGTAAACCATCAAACACCCACACAACAATCTGAACCAGTTTATGTCCAAAGTGTGGCTTCATCTCAACCAGTGCATTTATCAGAACCAAGTTTGCAATCTTTCCTTGCTCCAACCAGTTCTTCACAACCTATTGTATCATCAATGCCATCATTCTCAAACATGTTCAATGATTCACTAACAGTGAGATCCAAGTCATATGCCAGGAAGCCACCTATGAGGTCTGACTCTATTAAAGGACCAAAAGATGCCAACAAGAAGGTTTGGAGGCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

133

Amino Acids

14.69

Weight (kDa)

5.49

Isoelectric Point (pI)

58.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 181
AclWI GGATC 1 cut(s) 309
AcsI RAATTY 1 cut(s) 55
AfiI CCNNNNNNNGG 1 cut(s) 181
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 2 cut(s) 11, 295
AjnI CCWGG 1 cut(s) 329
AjuI GAANNNNNNNTTGG 2 cut(s) 232, 264
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
AlwI GGATC 1 cut(s) 309
AoxI GGCC 1 cut(s) 395
ApoI RAATTY 1 cut(s) 55
AspS9I GGNCC 1 cut(s) 365
AvaII GGWCC 1 cut(s) 365
BccI CCATC 2 cut(s) 144, 283
BciT130I CCWGG 1 cut(s) 331
Bme1390I CCNGG 1 cut(s) 331
Bme18I GGWCC 1 cut(s) 365
BmgT120I GGNCC 1 cut(s) 365
BmrFI CCNGG 1 cut(s) 331
BmsI GCATC 3 cut(s) 103, 111, 364
Bsc4I CCNNNNNNNGG 1 cut(s) 181
Bse1I ACTGG 3 cut(s) 164, 197, 243
BseBI CCWGG 1 cut(s) 331
BseLI CCNNNNNNNGG 1 cut(s) 181
BseNI ACTGG 3 cut(s) 164, 197, 243
BshFI GGCC 1 cut(s) 397
BslI CCNNNNNNNGG 1 cut(s) 181
BsnI GGCC 1 cut(s) 397
Bsp143I GATC 1 cut(s) 314
BspANI GGCC 1 cut(s) 397
BspPI GGATC 1 cut(s) 309
BsrI ACTGG 3 cut(s) 164, 197, 243
BssMI GATC 1 cut(s) 314
Bst2UI CCWGG 1 cut(s) 331
Bst4CI ACNGT 1 cut(s) 310
BstC8I GCNNGC 1 cut(s) 89
BstKTI GATC 1 cut(s) 317
BstMBI GATC 1 cut(s) 314
BstNI CCWGG 1 cut(s) 331
BstNSI RCATGY 2 cut(s) 91, 292
BstSCI CCNGG 1 cut(s) 329
BstX2I RGATCY 1 cut(s) 314
BstYI RGATCY 1 cut(s) 314
BsuRI GGCC 1 cut(s) 397
BtsIMutI CAGTG 2 cut(s) 204, 315
Cac8I GCNNGC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 365
CspCI CAANNNNNGTGG 2 cut(s) 51, 86
CviAII CATG 3 cut(s) 68, 88, 289
CviJI RGCY 4 cut(s) 14, 185, 337, 397
CviKI_1 RGCY 4 cut(s) 14, 185, 337, 397
DpnI GATC 1 cut(s) 316
DpnII GATC 1 cut(s) 314
Eco147I AGGCCT 1 cut(s) 397
Eco47I GGWCC 1 cut(s) 365
EcoRII CCWGG 1 cut(s) 329
FaeI CATG 3 cut(s) 71, 91, 292
FalI AAGNNNNNCTT 2 cut(s) 169, 201
FatI CATG 3 cut(s) 67, 87, 288
FauNDI CATATG 2 cut(s) 94, 325
HaeIII GGCC 1 cut(s) 397
Hin1II CATG 3 cut(s) 71, 91, 292
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HinfI GANTC 2 cut(s) 299, 353
HpaI GTTAAC 1 cut(s) 25
Hpy166II GTNNAC 2 cut(s) 25, 133
Hpy188I TCNGA 4 cut(s) 43, 160, 211, 352
Hpy8I GTNNAC 2 cut(s) 25, 133
HpyAV CCTTC 1 cut(s) 379
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4V TGCA 5 cut(s) 4, 62, 124, 202, 223
Hsp92II CATG 3 cut(s) 71, 91, 292
KspAI GTTAAC 1 cut(s) 25
Kzo9I GATC 1 cut(s) 314
LmnI GCTCC 1 cut(s) 241
LpnPI CCDG 6 cut(s) 110, 177, 210, 256, 316, 343
LweI GCATC 3 cut(s) 103, 111, 364
MalI GATC 1 cut(s) 316
MboI GATC 1 cut(s) 314
MboII GAAGA 1 cut(s) 240
MflI RGATCY 1 cut(s) 314
MluCI AATT 2 cut(s) 37, 55
MlyI GAGTC 1 cut(s) 347
MmeI TCCRAC 1 cut(s) 263
MnlI CCTC 3 cut(s) 121, 339, 387
MseI TTAA 2 cut(s) 24, 360
MspR9I CCNGG 1 cut(s) 331
MvaI CCWGG 1 cut(s) 331
NdeI CATATG 2 cut(s) 94, 325
NdeII GATC 1 cut(s) 314
NlaIII CATG 3 cut(s) 71, 91, 292
NspI RCATGY 2 cut(s) 91, 292
PaeI GCATGC 1 cut(s) 91
PceI AGGCCT 1 cut(s) 397
PciI ACATGT 1 cut(s) 288
PfeI GAWTC 1 cut(s) 299
PflMI CCANNNNNTGG 1 cut(s) 181
PleI GAGTC 1 cut(s) 347
PpsI GAGTC 1 cut(s) 347
PscI ACATGT 1 cut(s) 288
Psp6I CCWGG 1 cut(s) 329
PspGI CCWGG 1 cut(s) 329
PspPI GGNCC 1 cut(s) 365
PsuI RGATCY 1 cut(s) 314
SaqAI TTAA 2 cut(s) 24, 360
Sau3AI GATC 1 cut(s) 314
Sau96I GGNCC 1 cut(s) 365
SchI GAGTC 1 cut(s) 347
ScrFI CCNGG 1 cut(s) 331
SetI ASST 7 cut(s) 9, 16, 132, 259, 343, 350, 390
SfaNI GCATC 3 cut(s) 103, 111, 364
SinI GGWCC 1 cut(s) 365
SphI GCATGC 1 cut(s) 91
Sse9I AATT 2 cut(s) 37, 55
SseBI AGGCCT 1 cut(s) 397
StuI AGGCCT 1 cut(s) 397
StyD4I CCNGG 1 cut(s) 329
TaaI ACNGT 1 cut(s) 310
TasI AATT 2 cut(s) 37, 55
TfiI GAWTC 1 cut(s) 299
Tru1I TTAA 2 cut(s) 24, 360
Tru9I TTAA 2 cut(s) 24, 360
TscAI CASTG 2 cut(s) 204, 315
TspDTI ATGAA 2 cut(s) 111, 177
TspRI CASTG 2 cut(s) 204, 315
Van91I CCANNNNNTGG 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 365
XapI RAATTY 1 cut(s) 55
XceI RCATGY 2 cut(s) 91, 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.