Rh4DG308900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
53081127 .. 53085465
4339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG308900.1

Sequence Viewer

Length: 423 bp
ATGGAGGTGCCAAGTGCGAGTGAAAACAATATTGAGACAACTACAATTATTGGTAATGTCAATCAGGTGCTATTTGAGAATCCAAACAATGTGACCATTGAATTAGGTGGGATACCACAAAATGATGGCTCTGCAATTGAGGATAGAGTTGAAGGCCAAACTTATGCATCTTCTCTGCCAAATTCATCTACACAAGCTTTCTCTCAAACATTACCCAAGCCTCACTCAAGCTCACAATCTAAGGTCTCATCCCCAACAAATTTCTCATCTGTTTACATTGATGGTAAAACAGGATTCCCAATGAGGTGGAAGTCAGCTGCAAAGAATAACAAACCATTTAAAACACCAAGAGGGAATTGTGCAAAAGTGGGGATCCAAAAGGAACCAAAAGCAGGAACCAACAAGACAATTTGGAAGCCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

15.1

Weight (kDa)

9.3

Isoelectric Point (pI)

45.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 7
AclWI GGATC 2 cut(s) 367, 380
AcsI RAATTY 2 cut(s) 181, 259
AfiI CCNNNNNNNGG 1 cut(s) 392
AgsI TTSAA 2 cut(s) 101, 152
AluBI AGCT 3 cut(s) 197, 231, 317
AluI AGCT 3 cut(s) 197, 231, 317
Alw26I GTCTC 2 cut(s) 29, 250
AlwI GGATC 2 cut(s) 367, 380
AoxI GGCC 1 cut(s) 154
ApeKI GCWGC 1 cut(s) 317
ApoI RAATTY 2 cut(s) 181, 259
BamHI GGATCC 1 cut(s) 372
BanI GGYRCC 1 cut(s) 7
BbvI GCAGC 1 cut(s) 304
BccI CCATC 2 cut(s) 119, 275
BciVI GTATCC 1 cut(s) 105
BcoDI GTCTC 2 cut(s) 29, 250
BfuI GTATCC 1 cut(s) 105
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
BmiI GGNNCC 4 cut(s) 9, 374, 384, 397
BmsI GCATC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 211
BsaI GGTCTC 1 cut(s) 250
Bsc4I CCNNNNNNNGG 1 cut(s) 392
BseGI GGATG 1 cut(s) 248
BseLI CCNNNNNNNGG 1 cut(s) 392
BseXI GCAGC 1 cut(s) 304
BshFI GGCC 1 cut(s) 156
BshNI GGYRCC 1 cut(s) 7
BslI CCNNNNNNNGG 1 cut(s) 392
BsmAI GTCTC 2 cut(s) 29, 250
BsnI GGCC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 250
Bsp143I GATC 1 cut(s) 372
BspANI GGCC 1 cut(s) 156
BspLI GGNNCC 4 cut(s) 9, 374, 384, 397
BspPI GGATC 2 cut(s) 367, 380
BspT107I GGYRCC 1 cut(s) 7
BspTNI GGTCTC 1 cut(s) 250
BssMI GATC 1 cut(s) 372
BstDEI CTNAG 1 cut(s) 240
BstF5I GGATG 1 cut(s) 248
BstKTI GATC 1 cut(s) 375
BstMAI GTCTC 2 cut(s) 29, 250
BstMBI GATC 1 cut(s) 372
BstV1I GCAGC 1 cut(s) 304
BstX2I RGATCY 1 cut(s) 372
BstXI CCANNNNNNTGG 1 cut(s) 306
BstYI RGATCY 1 cut(s) 372
BsuI GTATCC 1 cut(s) 105
BsuRI GGCC 1 cut(s) 156
BtsCI GGATG 1 cut(s) 248
CviJI RGCY 7 cut(s) 129, 156, 197, 220, 231, 317, 418
CviKI_1 RGCY 7 cut(s) 129, 156, 197, 220, 231, 317, 418
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 374
DpnII GATC 1 cut(s) 372
DraI TTTAAA 1 cut(s) 340
Eco31I GGTCTC 1 cut(s) 250
EcoT22I ATGCAT 1 cut(s) 169
FaiI YATR 1 cut(s) 165
Fnu4HI GCNGC 1 cut(s) 318
FokI GGATG 1 cut(s) 235
Fsp4HI GCNGC 1 cut(s) 318
GluI GCNGC 1 cut(s) 318
HaeIII GGCC 1 cut(s) 156
HindIII AAGCTT 1 cut(s) 195
HinfI GANTC 2 cut(s) 79, 294
Hpy166II GTNNAC 1 cut(s) 274
Hpy8I GTNNAC 1 cut(s) 274
HpyAV CCTTC 1 cut(s) 146
HpyCH4V TGCA 4 cut(s) 134, 167, 320, 362
HpyF3I CTNAG 1 cut(s) 240
Kzo9I GATC 1 cut(s) 372
LpnPI CCDG 3 cut(s) 50, 276, 378
Lsp1109I GCAGC 1 cut(s) 304
LweI GCATC 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 91
MalI GATC 1 cut(s) 374
MboI GATC 1 cut(s) 372
MboII GAAGA 1 cut(s) 162
MfeI CAATTG 1 cut(s) 135
MflI RGATCY 1 cut(s) 372
MluCI AATT 7 cut(s) 45, 101, 135, 181, 259, 355, 408
MnlI CCTC 4 cut(s) 133, 231, 297, 344
Mph1103I ATGCAT 1 cut(s) 169
MseI TTAA 1 cut(s) 339
MspA1I CMGCKG 1 cut(s) 317
MunI CAATTG 1 cut(s) 135
NdeII GATC 1 cut(s) 372
NlaIV GGNNCC 4 cut(s) 9, 374, 384, 397
NmuCI GTSAC 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 169
PfeI GAWTC 2 cut(s) 79, 294
PkrI GCNGC 1 cut(s) 319
PspN4I GGNNCC 4 cut(s) 9, 374, 384, 397
PsuI RGATCY 1 cut(s) 372
PvuII CAGCTG 1 cut(s) 317
SaqAI TTAA 1 cut(s) 339
SatI GCNGC 1 cut(s) 318
Sau3AI GATC 1 cut(s) 372
SetI ASST 8 cut(s) 9, 69, 109, 199, 233, 246, 308, 319
SfaNI GCATC 1 cut(s) 176
SmlI CTYRAG 1 cut(s) 226
SmoI CTYRAG 1 cut(s) 226
Sse9I AATT 7 cut(s) 45, 101, 135, 181, 259, 355, 408
SspI AATATT 1 cut(s) 31
TasI AATT 7 cut(s) 45, 101, 135, 181, 259, 355, 408
TfiI GAWTC 2 cut(s) 79, 294
Tru1I TTAA 1 cut(s) 339
Tru9I TTAA 1 cut(s) 339
TseFI GTSAC 1 cut(s) 91
TseI GCWGC 1 cut(s) 317
Tsp45I GTSAC 1 cut(s) 91
TspDTI ATGAA 1 cut(s) 174
XapI RAATTY 2 cut(s) 181, 259
Zsp2I ATGCAT 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.