Rh6DG037800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
3926253 .. 3926926
674 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG037800.1

Sequence Viewer

Length: 294 bp
ATGACGCTGGTACCATCTATGAATGCAAATAATGTTGAGACAGCTCCAAGTGCTAGTTTTGTCAATGAGGTGCCAAGTGTGAATGAAAACAATATTGAGACAACCACAAATGCTGCTAATGTCAATCAGGTGCCATTTGAGAATCCAAACAACGTGACCATTGAATTAGGTGGGATACCACAAAATGATGGTTCTACAATTGAGGAAATAATGGGTGATAAAGTTGAAGGCCAAACTTATGCATCTTCTCAGCCAACTTCATCTACACAAGTTTTCTCTCAAACATTACCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.27

Weight (kDa)

4.05

Isoelectric Point (pI)

57.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 10
AccB1I GGYRCC 3 cut(s) 10, 70, 130
AfaI GTAC 1 cut(s) 12
AgsI TTSAA 2 cut(s) 164, 227
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 2 cut(s) 32, 92
AoxI GGCC 1 cut(s) 229
ApeKI GCWGC 1 cut(s) 113
Asp718I GGTACC 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 227
BaeI ACNNNNGTAYC 1 cut(s) 27
BanI GGYRCC 3 cut(s) 10, 70, 130
BbvI GCAGC 1 cut(s) 100
BccI CCATC 2 cut(s) 22, 182
BciVI GTATCC 1 cut(s) 168
BcoDI GTCTC 2 cut(s) 32, 92
BfaI CTAG 2 cut(s) 54, 292
BfuI GTATCC 1 cut(s) 168
BisI GCNGC 1 cut(s) 114
BlsI GCNGC 1 cut(s) 115
BmiI GGNNCC 3 cut(s) 12, 72, 132
BmsI GCATC 1 cut(s) 251
BseMII CTCAG 1 cut(s) 263
BseXI GCAGC 1 cut(s) 100
BshFI GGCC 1 cut(s) 231
BshNI GGYRCC 3 cut(s) 10, 70, 130
BsmAI GTCTC 2 cut(s) 32, 92
BsmI GAATGC 1 cut(s) 28
BsnI GGCC 1 cut(s) 231
BspANI GGCC 1 cut(s) 231
BspCNI CTCAG 1 cut(s) 262
BspLI GGNNCC 3 cut(s) 12, 72, 132
BspT107I GGYRCC 3 cut(s) 10, 70, 130
BstDEI CTNAG 1 cut(s) 249
BstMAI GTCTC 2 cut(s) 32, 92
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstV1I GCAGC 1 cut(s) 100
BsuI GTATCC 1 cut(s) 168
BsuRI GGCC 1 cut(s) 231
CseI GACGC 1 cut(s) 13
Csp6I GTAC 1 cut(s) 11
CviJI RGCY 3 cut(s) 44, 231, 253
CviKI_1 RGCY 3 cut(s) 44, 231, 253
CviQI GTAC 1 cut(s) 11
DdeI CTNAG 1 cut(s) 249
EcoT22I ATGCAT 1 cut(s) 244
FaiI YATR 2 cut(s) 20, 240
Fnu4HI GCNGC 1 cut(s) 114
Fsp4HI GCNGC 1 cut(s) 114
FspBI CTAG 2 cut(s) 54, 292
GluI GCNGC 1 cut(s) 114
HaeIII GGCC 1 cut(s) 231
HgaI GACGC 1 cut(s) 13
HinfI GANTC 1 cut(s) 142
HphI GGTGA 1 cut(s) 227
HpyAV CCTTC 1 cut(s) 221
HpyCH4IV ACGT 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 26, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 249
HpySE526I ACGT 1 cut(s) 153
KpnI GGTACC 1 cut(s) 14
LmnI GCTCC 1 cut(s) 49
LpnPI CCDG 1 cut(s) 113
Lsp1109I GCAGC 1 cut(s) 100
LweI GCATC 1 cut(s) 251
MaeI CTAG 2 cut(s) 54, 292
MaeII ACGT 1 cut(s) 153
MaeIII GTNAC 1 cut(s) 154
MboII GAAGA 1 cut(s) 237
MfeI CAATTG 1 cut(s) 198
MluCI AATT 2 cut(s) 164, 198
MnlI CCTC 2 cut(s) 61, 196
Mph1103I ATGCAT 1 cut(s) 244
MunI CAATTG 1 cut(s) 198
Mva1269I GAATGC 1 cut(s) 28
MwoI GCNNNNNNNGC 1 cut(s) 50
NlaIV GGNNCC 3 cut(s) 12, 72, 132
NmuCI GTSAC 1 cut(s) 154
NsiI ATGCAT 1 cut(s) 244
PctI GAATGC 1 cut(s) 28
PfeI GAWTC 1 cut(s) 142
PkrI GCNGC 1 cut(s) 115
PspN4I GGNNCC 3 cut(s) 12, 72, 132
RsaI GTAC 1 cut(s) 12
RsaNI GTAC 1 cut(s) 11
SatI GCNGC 1 cut(s) 114
SetI ASST 5 cut(s) 46, 72, 132, 156, 172
SfaNI GCATC 1 cut(s) 251
SgeI CNNG 7 cut(s) 20, 60, 66, 87, 140, 166, 281
Sse9I AATT 2 cut(s) 164, 198
SspI AATATT 1 cut(s) 94
SspMI CTAG 2 cut(s) 54, 292
TaiI ACGT 1 cut(s) 156
TasI AATT 2 cut(s) 164, 198
TfiI GAWTC 1 cut(s) 142
TseFI GTSAC 1 cut(s) 154
TseI GCWGC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 154
TspDTI ATGAA 3 cut(s) 35, 99, 249
XspI CTAG 2 cut(s) 54, 292
Zsp2I ATGCAT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.