Rh3AG324200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
45574851 .. 45595926
21076 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG324200.1

Sequence Viewer

Length: 390 bp
ATGTACTGGTTTCTGTTACCTGGAAGTATTCAAGGAGAAGGTTGGTTACCAATATGCAAAGACAAGGATGTGTTAGATATGTTGAAGTTCATGCCAAGTAATAGAATATTGCAGATTTACATTGTTGGAGGAGGTGTAAGAAAAAAAGAGGAAACTGAGCTAGAGGATGAGGGCAGGGGTTCTCTTAAAGAGGTTGATCACCAGAAGTATATTGGAAACATGGTAGAAGACCTGGAAGAAGTGATTGATGATGGTCCTGCTGTGACAAGCAATTATTGTGCAAAGATTTCAAATGGGGCAGAGGTTTCAAGAAAGGCAAATGAAAAACGAAACAAGGGAGTTGCGATTGTGGGAAACATTCGGAAAATGAATTGGATCAAAGGAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.5

Weight (kDa)

5.9

Isoelectric Point (pI)

36.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 383
AfaI GTAC 1 cut(s) 5
AgsI TTSAA 4 cut(s) 32, 85, 291, 309
AjnI CCWGG 2 cut(s) 19, 231
AluBI AGCT 1 cut(s) 160
AluI AGCT 1 cut(s) 160
AlwI GGATC 1 cut(s) 383
AspS9I GGNCC 1 cut(s) 254
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 254
BarI GAAGNNNNNNTAC 2 cut(s) 30, 62
BbsI GAAGAC 1 cut(s) 234
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 2 cut(s) 21, 233
BclI TGATCA 1 cut(s) 196
BfaI CTAG 1 cut(s) 161
Bme1390I CCNGG 2 cut(s) 21, 233
Bme18I GGWCC 1 cut(s) 254
BmgT120I GGNCC 1 cut(s) 254
BmrFI CCNGG 2 cut(s) 21, 233
BpiI GAAGAC 1 cut(s) 234
BsaXI ACNNNNNCTCC 2 cut(s) 120, 150
Bse1I ACTGG 1 cut(s) 11
BseBI CCWGG 2 cut(s) 21, 233
BseGI GGATG 2 cut(s) 73, 172
BseMII CTCAG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 11
BseRI GAGGAG 1 cut(s) 144
Bsp143I GATC 2 cut(s) 196, 375
BspCNI CTCAG 1 cut(s) 148
BspPI GGATC 1 cut(s) 383
BsrI ACTGG 1 cut(s) 11
BssMI GATC 2 cut(s) 196, 375
Bst2UI CCWGG 2 cut(s) 21, 233
BstDEI CTNAG 1 cut(s) 156
BstEII GGTNACC 1 cut(s) 45
BstF5I GGATG 2 cut(s) 73, 172
BstKTI GATC 2 cut(s) 199, 378
BstMBI GATC 2 cut(s) 196, 375
BstNI CCWGG 2 cut(s) 21, 233
BstPI GGTNACC 1 cut(s) 45
BstSCI CCNGG 2 cut(s) 19, 231
BstV2I GAAGAC 1 cut(s) 234
BtsCI GGATG 2 cut(s) 73, 172
Cfr13I GGNCC 1 cut(s) 254
Csp6I GTAC 1 cut(s) 4
CviAII CATG 2 cut(s) 91, 220
CviJI RGCY 1 cut(s) 160
CviKI_1 RGCY 1 cut(s) 160
CviQI GTAC 1 cut(s) 4
DdeI CTNAG 1 cut(s) 156
DpnI GATC 2 cut(s) 198, 377
DpnII GATC 2 cut(s) 196, 375
Eco47I GGWCC 1 cut(s) 254
Eco91I GGTNACC 1 cut(s) 45
EcoO65I GGTNACC 1 cut(s) 45
EcoRII CCWGG 2 cut(s) 19, 231
FaeI CATG 2 cut(s) 94, 223
FaiI YATR 5 cut(s) 55, 80, 92, 210, 221
FatI CATG 2 cut(s) 90, 219
FbaI TGATCA 1 cut(s) 196
FokI GGATG 2 cut(s) 80, 179
FspBI CTAG 1 cut(s) 161
Hin1II CATG 2 cut(s) 94, 223
HphI GGTGA 1 cut(s) 191
Hpy188I TCNGA 1 cut(s) 363
Hpy188III TCNNGA 1 cut(s) 309
HpyAV CCTTC 1 cut(s) 32
HpyCH4V TGCA 3 cut(s) 57, 112, 281
HpyF3I CTNAG 1 cut(s) 156
Hsp92II CATG 2 cut(s) 94, 223
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 196, 375
LpnPI CCDG 7 cut(s) 6, 33, 160, 215, 218, 245, 270
MaeI CTAG 1 cut(s) 161
MaeIII GTNAC 3 cut(s) 15, 45, 262
MalI GATC 2 cut(s) 198, 377
MboI GATC 2 cut(s) 196, 375
MboII GAAGA 2 cut(s) 239, 248
MluCI AATT 2 cut(s) 271, 370
MmeI TCCRAC 1 cut(s) 106
MnlI CCTC 7 cut(s) 122, 125, 142, 157, 163, 184, 295
MseI TTAA 2 cut(s) 186, 388
MspR9I CCNGG 2 cut(s) 21, 233
MvaI CCWGG 2 cut(s) 21, 233
NdeII GATC 2 cut(s) 196, 375
NlaIII CATG 2 cut(s) 94, 223
NmuCI GTSAC 1 cut(s) 262
Psp6I CCWGG 2 cut(s) 19, 231
PspEI GGTNACC 1 cut(s) 45
PspGI CCWGG 2 cut(s) 19, 231
PspPI GGNCC 1 cut(s) 254
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 186, 388
Sau3AI GATC 2 cut(s) 196, 375
Sau96I GGNCC 1 cut(s) 254
ScrFI CCNGG 2 cut(s) 21, 233
SetI ASST 7 cut(s) 22, 43, 136, 162, 195, 234, 306
SinI GGWCC 1 cut(s) 254
Sse9I AATT 2 cut(s) 271, 370
SspI AATATT 1 cut(s) 108
SspMI CTAG 1 cut(s) 161
StyD4I CCNGG 2 cut(s) 19, 231
TasI AATT 2 cut(s) 271, 370
TatI WGTACW 1 cut(s) 3
Tru1I TTAA 2 cut(s) 186, 388
Tru9I TTAA 2 cut(s) 186, 388
TseFI GTSAC 1 cut(s) 262
Tsp45I GTSAC 1 cut(s) 262
TspDTI ATGAA 3 cut(s) 79, 336, 383
VpaK11BI GGWCC 1 cut(s) 254
XcmI CCANNNNNNNNNTGG 1 cut(s) 209
XspI CTAG 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.