Rh3CG356600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
43720378 .. 43720716
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG356600.1

Sequence Viewer

Length: 339 bp
ATGGTAGAAGACCTGGAAGAAGTGATTGATGATGGTCCTGCTGTGACAAGCAATTATTGTGCAAAGATTTCAAATGGGGCAGAGGTTTCAAGAGAGGCAAATGGAAAACGAAACAAGGGAGGTAGGCCTAAGAATAAGAAGGATGTGGTTACTCAGTTGACAAACCAGTTTATAAATGTTAAGGCTAGTAAGACAATTGCAGATGATAATGTGGTGGGTGAAAATAAAAATAGACGTAGAATGAAGCAAAAGGCATGCAAGATGAAGAAGAAATCAAGACCATATGACACCAGATTTATGGGGGAATCAGGAGTTAATAGTTTGCCAATTAGGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.49

Weight (kDa)

9.86

Isoelectric Point (pI)

48.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 173
AgsI TTSAA 2 cut(s) 72, 90
AjnI CCWGG 1 cut(s) 12
AoxI GGCC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 35
AsuHPI GGTGA 1 cut(s) 230
AvaII GGWCC 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 15
BccI CCATC 1 cut(s) 26
BciT130I CCWGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 14
BpiI GAAGAC 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 166
BseBI CCWGG 1 cut(s) 14
BseGI GGATG 1 cut(s) 148
BseMII CTCAG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 166
BshFI GGCC 1 cut(s) 127
BsnI GGCC 1 cut(s) 127
BspANI GGCC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 166
BsrI ACTGG 1 cut(s) 166
Bst2UI CCWGG 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 256
BstDEI CTNAG 2 cut(s) 129, 153
BstF5I GGATG 1 cut(s) 148
BstNI CCWGG 1 cut(s) 14
BstNSI RCATGY 1 cut(s) 258
BstSCI CCNGG 1 cut(s) 12
BstV2I GAAGAC 1 cut(s) 15
BstXI CCANNNNNNTGG 1 cut(s) 298
BsuRI GGCC 1 cut(s) 127
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 256
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 1 cut(s) 255
CviJI RGCY 2 cut(s) 127, 185
CviKI_1 RGCY 2 cut(s) 127, 185
DdeI CTNAG 2 cut(s) 129, 153
Eco147I AGGCCT 1 cut(s) 127
Eco47I GGWCC 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 12
FaeI CATG 1 cut(s) 258
FaiI YATR 5 cut(s) 173, 256, 283, 285, 299
FatI CATG 1 cut(s) 254
FauNDI CATATG 1 cut(s) 283
FokI GGATG 1 cut(s) 155
FspBI CTAG 1 cut(s) 186
HaeIII GGCC 1 cut(s) 127
Hin1II CATG 1 cut(s) 258
HincII GTYRAC 1 cut(s) 159
HindII GTYRAC 1 cut(s) 159
HinfI GANTC 1 cut(s) 305
HphI GGTGA 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 159
Hpy188III TCNNGA 3 cut(s) 90, 276, 309
Hpy8I GTNNAC 1 cut(s) 159
HpyAV CCTTC 1 cut(s) 133
HpyCH4IV ACGT 1 cut(s) 235
HpyCH4V TGCA 3 cut(s) 62, 200, 258
HpyF3I CTNAG 2 cut(s) 129, 153
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 1 cut(s) 258
LpnPI CCDG 5 cut(s) 26, 51, 179, 294, 304
MaeI CTAG 1 cut(s) 186
MaeII ACGT 1 cut(s) 235
MaeIII GTNAC 2 cut(s) 43, 148
MboII GAAGA 4 cut(s) 20, 29, 277, 280
MfeI CAATTG 1 cut(s) 195
MluCI AATT 3 cut(s) 52, 195, 327
MnlI CCTC 3 cut(s) 76, 88, 113
MseI TTAA 3 cut(s) 180, 315, 337
MspR9I CCNGG 1 cut(s) 14
MunI CAATTG 1 cut(s) 195
MvaI CCWGG 1 cut(s) 14
NdeI CATATG 1 cut(s) 283
NlaIII CATG 1 cut(s) 258
NmuCI GTSAC 1 cut(s) 43
NspI RCATGY 1 cut(s) 258
PaeI GCATGC 1 cut(s) 258
PceI AGGCCT 1 cut(s) 127
PfeI GAWTC 1 cut(s) 305
PsiI TTATAA 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 12
PspGI CCWGG 1 cut(s) 12
PspPI GGNCC 1 cut(s) 35
SaqAI TTAA 3 cut(s) 180, 315, 337
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 14
SetI ASST 4 cut(s) 15, 87, 124, 238
SinI GGWCC 1 cut(s) 35
SphI GCATGC 1 cut(s) 258
Sse9I AATT 3 cut(s) 52, 195, 327
SseBI AGGCCT 1 cut(s) 127
SspMI CTAG 1 cut(s) 186
StuI AGGCCT 1 cut(s) 127
StyD4I CCNGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 238
TasI AATT 3 cut(s) 52, 195, 327
TfiI GAWTC 1 cut(s) 305
Tru1I TTAA 3 cut(s) 180, 315, 337
Tru9I TTAA 3 cut(s) 180, 315, 337
TseFI GTSAC 1 cut(s) 43
Tsp45I GTSAC 1 cut(s) 43
TspDTI ATGAA 2 cut(s) 257, 278
VpaK11BI GGWCC 1 cut(s) 35
XceI RCATGY 1 cut(s) 258
XspI CTAG 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.