Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6B

Orthogroup ID

OG0004256

Physical Location & Seq

Genomic Coordinates Reverse (-)

13915400 .. 13916755

Gene Structure 1356 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6BG089000.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 639 bp

ATGCTTTCATTTCTACAAAATACAAATATACTCAAATTGTATGTTGTTTCTGGAGGTGTTAGAAGAAAAGAAGAAGCGAAGTATGAATGGAAAAATGGGATAGCTCCTCCAGATGTGGACCATGAAAAGTATATTGACAATGTCATTGATGATTTAGAAGAAGTGGTCCAAGCAAGACATGGCTCAGTTGAGGAGAATTTAATACAAAATGTAGATGAGATGGTAAGTAATAAGGGTGTTGCTGCTGTGCATTTATCTGAGGCAAACATAACTCCCAAAGATAAGGGAAAAAGAAAAGTCTCACAAACCACCAAGAAGAGAAAAATTGGTAAGGCCAAAGCATTGGAAATACTAGGTAATAAAGTTGAAGGCCAAACTTATGCATCTTCTCAGCCAACTTCATCTACACAACCTTTCTCTCAAACATTATCCCAGCCTCACTCAAGCTCACAATCCAAGGTCTCATCCCCAACAAATTTCTCATCTATTTACATTGATGGTAAAACAGGATTTCCAATGAGGTGGAAGTCAGCTGCAAAAAATAACAAACCATTTAAAACACCAAGAGGCAATTGTGCAAAAGTGGGGATCCAAACGGAACCAAAAGCAGGAACCAACAAGACAATTTGGAAGCCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

212

Amino Acids

23.41

Weight (kDa)

9.69

Isoelectric Point (pI)

44.0

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004256)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0464961 RchiOBHm_Chr6g0255261
rosa_laevigata	RLG00000009797 RLG00000013904 RLG00000017951 RLG00000020592 RLG00000031953
rosa_multiflora	Rmu_sc0007235.1_g000002
rosa_roxburghii	Rroxscaffold_178G00437270 Rroxscaffold_1G00042710 Rroxscaffold_2G00108680 Rroxscaffold_2G00153900 Rroxscaffold_7G00205440
rosa_samantha	Rh2AG195700 Rh2AG195800 Rh2DG203200 Rh2DG203300 Rh3AG324200 Rh3BG241700 Rh3BG314600 Rh3CG356600 Rh4AG041500 Rh4AG218600 Rh4DG143100 Rh4DG145700 Rh4DG308900 Rh6BG089000 Rh6CG041500 Rh6DG037800 Rh7AG355100 Rh7BG392400 Rh7CG372300
rosa_wichuraiana	Rw4G012260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	583, 596
AcsI	RAATTY	2 cut(s)	196, 475
AfiI	CCNNNNNNNGG	1 cut(s)	608
AgsI	TTSAA	1 cut(s)	368
AluBI	AGCT	3 cut(s)	104, 447, 533
AluI	AGCT	3 cut(s)	104, 447, 533
Alw26I	GTCTC	2 cut(s)	304, 466
AlwI	GGATC	2 cut(s)	583, 596
AoxI	GGCC	2 cut(s)	333, 370
ApeKI	GCWGC	2 cut(s)	242, 533
ApoI	RAATTY	2 cut(s)	196, 475
AspS9I	GGNCC	2 cut(s)	118, 166
AvaII	GGWCC	2 cut(s)	118, 166
BamHI	GGATCC	1 cut(s)	588
BbvI	GCAGC	2 cut(s)	229, 520
BccI	CCATC	2 cut(s)	214, 491
BcoDI	GTCTC	2 cut(s)	304, 466
BfaI	CTAG	1 cut(s)	353
BisI	GCNGC	2 cut(s)	243, 534
BlsI	GCNGC	2 cut(s)	244, 535
Bme18I	GGWCC	2 cut(s)	118, 166
BmgT120I	GGNCC	2 cut(s)	118, 166
BmiI	GGNNCC	3 cut(s)	590, 600, 613
BmsI	GCATC	1 cut(s)	392
BpmI	CTGGAG	2 cut(s)	72, 93
BpuEI	CTTGAG	1 cut(s)	427
BsaI	GGTCTC	1 cut(s)	466
BsaJI	CCNNGG	1 cut(s)	456
Bsc4I	CCNNNNNNNGG	1 cut(s)	608
BseDI	CCNNGG	1 cut(s)	456
BseGI	GGATG	1 cut(s)	464
BseLI	CCNNNNNNNGG	1 cut(s)	608
BseMII	CTCAG	3 cut(s)	198, 249, 404
BseRI	GAGGAG	2 cut(s)	96, 206
BseXI	GCAGC	2 cut(s)	229, 520
BseYI	CCCAGC	1 cut(s)	432
BshFI	GGCC	2 cut(s)	335, 372
BslI	CCNNNNNNNGG	1 cut(s)	608
BsmAI	GTCTC	2 cut(s)	304, 466
BsnI	GGCC	2 cut(s)	335, 372
Bso31I	GGTCTC	1 cut(s)	466
Bsp143I	GATC	1 cut(s)	588
BspANI	GGCC	2 cut(s)	335, 372
BspCNI	CTCAG	3 cut(s)	197, 250, 403
BspLI	GGNNCC	3 cut(s)	590, 600, 613
BspPI	GGATC	2 cut(s)	583, 596
BspTNI	GGTCTC	1 cut(s)	466
BssECI	CCNNGG	1 cut(s)	456
BssMI	GATC	1 cut(s)	588
BssT1I	CCWWGG	1 cut(s)	456
Bst6I	CTCTTC	1 cut(s)	311
BstDEI	CTNAG	3 cut(s)	184, 258, 390
BstF5I	GGATG	1 cut(s)	464
BstKTI	GATC	1 cut(s)	591
BstMAI	GTCTC	2 cut(s)	304, 466
BstMBI	GATC	1 cut(s)	588
BstV1I	GCAGC	2 cut(s)	229, 520
BstX2I	RGATCY	1 cut(s)	588
BstXI	CCANNNNNNTGG	2 cut(s)	343, 522
BstYI	RGATCY	1 cut(s)	588
BsuRI	GGCC	2 cut(s)	335, 372
BtsCI	GGATG	1 cut(s)	464
Cfr13I	GGNCC	2 cut(s)	118, 166
CviAII	CATG	2 cut(s)	122, 179
CviJI	RGCY	9 cut(s)	104, 183, 335, 372, 394, 436, 447, 533, 634
CviKI_1	RGCY	9 cut(s)	104, 183, 335, 372, 394, 436, 447, 533, 634
DdeI	CTNAG	3 cut(s)	184, 258, 390
DpnI	GATC	1 cut(s)	590
DpnII	GATC	1 cut(s)	588
DraI	TTTAAA	1 cut(s)	556
Eam1104I	CTCTTC	1 cut(s)	311
EarI	CTCTTC	1 cut(s)	311
Eco130I	CCWWGG	1 cut(s)	456
Eco31I	GGTCTC	1 cut(s)	466
Eco47I	GGWCC	2 cut(s)	118, 166
EcoT14I	CCWWGG	1 cut(s)	456
EcoT22I	ATGCAT	1 cut(s)	385
ErhI	CCWWGG	1 cut(s)	456
FaeI	CATG	2 cut(s)	125, 182
FaiI	YATR	8 cut(s)	29, 42, 84, 123, 132, 180, 269, 381
FatI	CATG	2 cut(s)	121, 178
Fnu4HI	GCNGC	2 cut(s)	243, 534
FokI	GGATG	1 cut(s)	451
Fsp4HI	GCNGC	2 cut(s)	243, 534
FspBI	CTAG	1 cut(s)	353
GluI	GCNGC	2 cut(s)	243, 534
GsaI	CCCAGC	1 cut(s)	436
GsuI	CTGGAG	2 cut(s)	72, 93
HaeIII	GGCC	2 cut(s)	335, 372
Hin1II	CATG	2 cut(s)	125, 182
Hpy166II	GTNNAC	1 cut(s)	118
Hpy188I	TCNGA	1 cut(s)	259
Hpy188III	TCNNGA	2 cut(s)	51, 110
Hpy8I	GTNNAC	1 cut(s)	118
HpyAV	CCTTC	1 cut(s)	362
HpyCH4V	TGCA	4 cut(s)	250, 383, 536, 578
HpyF3I	CTNAG	3 cut(s)	184, 258, 390
Hsp92II	CATG	2 cut(s)	125, 182
Kzo9I	GATC	1 cut(s)	588
LmnI	GCTCC	1 cut(s)	109
LpnPI	CCDG	5 cut(s)	36, 123, 446, 492, 594
Lsp1109I	GCAGC	2 cut(s)	229, 520
LweI	GCATC	1 cut(s)	392
MaeI	CTAG	1 cut(s)	353
MalI	GATC	1 cut(s)	590
MboI	GATC	1 cut(s)	588
MboII	GAAGA	5 cut(s)	75, 83, 170, 328, 378
MfeI	CAATTG	1 cut(s)	571
MflI	RGATCY	1 cut(s)	588
MluCI	AATT	6 cut(s)	35, 196, 324, 475, 571, 624
MnlI	CCTC	7 cut(s)	47, 117, 184, 253, 447, 513, 560
Mph1103I	ATGCAT	1 cut(s)	385
MseI	TTAA	2 cut(s)	200, 555
MspA1I	CMGCKG	1 cut(s)	533
MunI	CAATTG	1 cut(s)	571
NdeII	GATC	1 cut(s)	588
NlaIII	CATG	2 cut(s)	125, 182
NlaIV	GGNNCC	3 cut(s)	590, 600, 613
NsiI	ATGCAT	1 cut(s)	385
PflFI	GACNNNGTC	1 cut(s)	140
PkrI	GCNGC	2 cut(s)	244, 535
PspFI	CCCAGC	1 cut(s)	432
PspN4I	GGNNCC	3 cut(s)	590, 600, 613
PspPI	GGNCC	2 cut(s)	118, 166
PsuI	RGATCY	1 cut(s)	588
PsyI	GACNNNGTC	1 cut(s)	140
PvuII	CAGCTG	1 cut(s)	533
SaqAI	TTAA	2 cut(s)	200, 555
SatI	GCNGC	2 cut(s)	243, 534
Sau3AI	GATC	1 cut(s)	588
Sau96I	GGNCC	2 cut(s)	118, 166
SetI	ASST	8 cut(s)	58, 106, 358, 415, 449, 462, 524, 535
SfaNI	GCATC	1 cut(s)	392
SinI	GGWCC	2 cut(s)	118, 166
SmlI	CTYRAG	1 cut(s)	442
SmoI	CTYRAG	1 cut(s)	442
Sse9I	AATT	6 cut(s)	35, 196, 324, 475, 571, 624
SspMI	CTAG	1 cut(s)	353
StyI	CCWWGG	1 cut(s)	456
TasI	AATT	6 cut(s)	35, 196, 324, 475, 571, 624
Tru1I	TTAA	2 cut(s)	200, 555
Tru9I	TTAA	2 cut(s)	200, 555
TseI	GCWGC	2 cut(s)	242, 533
TspDTI	ATGAA	3 cut(s)	99, 138, 390
TspGWI	ACGGA	1 cut(s)	611
Tth111I	GACNNNGTC	1 cut(s)	140
VpaK11BI	GGWCC	2 cut(s)	118, 166
XapI	RAATTY	2 cut(s)	196, 475
XcmI	CCANNNNNNNNNTGG	1 cut(s)	176
XspI	CTAG	1 cut(s)	353
Zsp2I	ATGCAT	1 cut(s)	385

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.