Rh2AG195700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
19566754 .. 19567080
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG195700.1

Sequence Viewer

Length: 327 bp
ATGTTGATCCTGACCATACTTGATTCTTGGCCCTTTTTAAATGAGATTTCAGAAGACTTAGGCTACAGAGAGCCACCAATTCAGTATTGGTTCAAGATGCCAGGAAGTAGAGATGGGGAGGAATTGTTGGAATTACATAATGATAGAGATGTTGCTAACATGGTTGCATTTAGGACCACAACCAAGTTGTTACAGATATACATAGTAGGTGGAGGTGTTAGAAGAAAAAAGGAAGCAAAGTTAGAGGATGAGACTGGAGAGGGTCCGAAACTAGTTGACCATAAAAAGTACTTGAATAATGTAGTTGAAGATTTAATGGATGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.51

Weight (kDa)

4.88

Isoelectric Point (pI)

42.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 290
AgsI TTSAA 3 cut(s) 94, 295, 308
AhlI ACTAGT 1 cut(s) 271
AjnI CCWGG 1 cut(s) 100
Alw26I GTCTC 1 cut(s) 245
AoxI GGCC 1 cut(s) 29
AspS9I GGNCC 3 cut(s) 30, 174, 263
AvaII GGWCC 2 cut(s) 174, 263
BbsI GAAGAC 1 cut(s) 60
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 245
BcuI ACTAGT 1 cut(s) 271
BfaI CTAG 1 cut(s) 272
BfmI CTRYAG 1 cut(s) 64
BmcAI AGTACT 1 cut(s) 290
Bme1390I CCNGG 1 cut(s) 102
Bme18I GGWCC 2 cut(s) 174, 263
BmgT120I GGNCC 3 cut(s) 30, 174, 263
BmiI GGNNCC 1 cut(s) 264
BmrFI CCNGG 1 cut(s) 102
BmsI GCATC 1 cut(s) 87
BpiI GAAGAC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 276
BsaXI ACNNNNNCTCC 2 cut(s) 110, 140
Bse1I ACTGG 1 cut(s) 259
BseBI CCWGG 1 cut(s) 102
BseGI GGATG 2 cut(s) 253, 325
BseNI ACTGG 1 cut(s) 259
BshFI GGCC 1 cut(s) 31
BsmAI GTCTC 1 cut(s) 245
BsnI GGCC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 6
BspANI GGCC 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 264
BsrI ACTGG 1 cut(s) 259
BssMI GATC 1 cut(s) 6
Bst2UI CCWGG 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 58
BstF5I GGATG 2 cut(s) 253, 325
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 245
BstMBI GATC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 60
BsuRI GGCC 1 cut(s) 31
BtsCI GGATG 2 cut(s) 253, 325
Cfr13I GGNCC 3 cut(s) 30, 174, 263
Csp6I GTAC 1 cut(s) 289
CviAII CATG 1 cut(s) 160
CviJI RGCY 3 cut(s) 31, 63, 73
CviKI_1 RGCY 3 cut(s) 31, 63, 73
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 1 cut(s) 58
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
DraI TTTAAA 1 cut(s) 39
Eco47I GGWCC 2 cut(s) 174, 263
EcoRII CCWGG 1 cut(s) 100
FaeI CATG 1 cut(s) 163
FaiI YATR 6 cut(s) 17, 138, 161, 199, 203, 282
FatI CATG 1 cut(s) 159
FokI GGATG 1 cut(s) 260
FspBI CTAG 1 cut(s) 272
GsuI CTGGAG 1 cut(s) 276
HaeIII GGCC 1 cut(s) 31
Hin1II CATG 1 cut(s) 163
HincII GTYRAC 1 cut(s) 277
HindII GTYRAC 1 cut(s) 277
HinfI GANTC 1 cut(s) 23
Hpy166II GTNNAC 1 cut(s) 277
Hpy188I TCNGA 2 cut(s) 52, 267
Hpy188III TCNNGA 2 cut(s) 10, 94
Hpy8I GTNNAC 1 cut(s) 277
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 58
Hsp92II CATG 1 cut(s) 163
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 4 cut(s) 23, 87, 114, 240
LweI GCATC 1 cut(s) 87
MaeI CTAG 1 cut(s) 272
MaeIII GTNAC 1 cut(s) 189
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 3 cut(s) 65, 234, 320
MluCI AATT 3 cut(s) 78, 122, 131
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 4 cut(s) 112, 206, 238, 253
MseI TTAA 2 cut(s) 38, 314
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
NdeII GATC 1 cut(s) 6
NlaIII CATG 1 cut(s) 163
NlaIV GGNNCC 1 cut(s) 264
PfeI GAWTC 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 264
PspPI GGNCC 3 cut(s) 30, 174, 263
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 2 cut(s) 38, 314
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 3 cut(s) 30, 174, 263
ScaI AGTACT 1 cut(s) 290
ScrFI CCNGG 1 cut(s) 102
SetI ASST 2 cut(s) 211, 217
SfaNI GCATC 1 cut(s) 87
SfcI CTRYAG 1 cut(s) 64
SinI GGWCC 2 cut(s) 174, 263
SpeI ACTAGT 1 cut(s) 271
Sse9I AATT 3 cut(s) 78, 122, 131
SspMI CTAG 1 cut(s) 272
StyD4I CCNGG 1 cut(s) 100
TasI AATT 3 cut(s) 78, 122, 131
TatI WGTACW 1 cut(s) 288
TfiI GAWTC 1 cut(s) 23
Tru1I TTAA 2 cut(s) 38, 314
Tru9I TTAA 2 cut(s) 38, 314
VpaK11BI GGWCC 2 cut(s) 174, 263
XcmI CCANNNNNNNNNTGG 1 cut(s) 84
XspI CTAG 1 cut(s) 272
ZrmI AGTACT 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.