Rh3BG241700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
22755524 .. 22757351
1828 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG241700.1

Sequence Viewer

Length: 213 bp
ATGTCGAGATATTTTAGACTGGATGGGGAGCCACCAACAAGGCATGAGTCAAAGAAACAAGAGGACAAAGAAGACTTGGAAGAAGTGATTGATGGTGATCTTGCTGTGACAACTTTACATGGGGCAAAGGTTTCAAGTAAGGCAAGTGGAAAGAGAAACAAGGGAGGTAGGCCAAAGAATAAGAAGGATGTGGTTACTCACTTGACAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

9.0

Isoelectric Point (pI)

54.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 135
AoxI GGCC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 107
BbsI GAAGAC 1 cut(s) 78
BccI CCATC 2 cut(s) 17, 86
BfaI CTAG 1 cut(s) 211
BmiI GGNNCC 1 cut(s) 30
BpiI GAAGAC 1 cut(s) 78
BsaBI GATNNNNATC 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 96
BseGI GGATG 2 cut(s) 28, 193
BseJI GATNNNNATC 1 cut(s) 96
BseNI ACTGG 1 cut(s) 24
BshFI GGCC 1 cut(s) 172
BsnI GGCC 1 cut(s) 172
Bsp143I GATC 1 cut(s) 97
BspANI GGCC 1 cut(s) 172
BspLI GGNNCC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 24
BssMI GATC 1 cut(s) 97
BstF5I GGATG 2 cut(s) 28, 193
BstKTI GATC 1 cut(s) 100
BstMBI GATC 1 cut(s) 97
BstV2I GAAGAC 1 cut(s) 78
BsuRI GGCC 1 cut(s) 172
BtsCI GGATG 2 cut(s) 28, 193
CviAII CATG 2 cut(s) 44, 119
CviJI RGCY 2 cut(s) 31, 172
CviKI_1 RGCY 2 cut(s) 31, 172
DpnI GATC 1 cut(s) 99
DpnII GATC 1 cut(s) 97
FaeI CATG 2 cut(s) 47, 122
FaiI YATR 2 cut(s) 45, 120
FatI CATG 2 cut(s) 43, 118
FokI GGATG 2 cut(s) 35, 200
FspBI CTAG 1 cut(s) 211
HaeIII GGCC 1 cut(s) 172
Hin1II CATG 2 cut(s) 47, 122
HinfI GANTC 1 cut(s) 47
HphI GGTGA 1 cut(s) 107
Hpy188III TCNNGA 1 cut(s) 6
HpyAV CCTTC 1 cut(s) 178
Hsp92II CATG 2 cut(s) 47, 122
Kzo9I GATC 1 cut(s) 97
LmnI GCTCC 1 cut(s) 28
LpnPI CCDG 1 cut(s) 5
MaeI CTAG 1 cut(s) 211
MaeIII GTNAC 2 cut(s) 106, 193
MalI GATC 1 cut(s) 99
MboI GATC 1 cut(s) 97
MboII GAAGA 2 cut(s) 83, 92
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 2 cut(s) 55, 158
NdeII GATC 1 cut(s) 97
NlaIII CATG 2 cut(s) 47, 122
NlaIV GGNNCC 1 cut(s) 30
NmuCI GTSAC 1 cut(s) 106
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 30
Sau3AI GATC 1 cut(s) 97
SchI GAGTC 1 cut(s) 56
SetI ASST 2 cut(s) 132, 169
SspMI CTAG 1 cut(s) 211
TaqI TCGA 1 cut(s) 5
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
XspI CTAG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.