Rroxscaffold_7G00205440

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0004256
Physical Location & Seq
Reverse (-)
55003962 .. 55007289
3328 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00205440.1

Sequence Viewer

Length: 489 bp
ATGACAAACAAAGCACAACTGATATGTCTGGATGAGAAAGGAGGGCATGAAATACTAGGTAATAAAGTTGAAGGCCAAACTTATGCATCTTCTCAGCCAACTTCATCTACACAACCTTTCTCTCAAACATTATCCCAGCCTCACTCAAGCTCACAATCCAAGGTCTCATCCCCAACAAATTTCTCATCTATTTACATTGATGGTAAAACAGGATTTCCAATGAGGTGGAAGTCAGCTGGGACCAAGAGGGATTTCAGCACTGCGATTGTCGAGCGGAAGAAGGCAAGAATGTCCTCGTCGTCGATGAGGCCATCTACGATGACAACTCAGTCATCACTCTCCACCCCGAGACCATGGAGAAGCTTTAGCTCTTTAGGGGCGACACAATCCTCATCAAGTGACAAGGTTCCGAGCAAAAAGCCCCCTACTCCTCACCCGCGAGTTGTGCTCGATTATCCGTTGGATGCAACAACTAAAGAAGCCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

17.6

Weight (kDa)

10.0

Isoelectric Point (pI)

61.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 328
AccBSI CCGCTC 1 cut(s) 274
AccII CGCG 1 cut(s) 439
AciI CCGC 2 cut(s) 274, 437
AcsI RAATTY 1 cut(s) 178
AgsI TTSAA 1 cut(s) 71
AjuI GAANNNNNNNTTGG 2 cut(s) 236, 268
AluBI AGCT 4 cut(s) 150, 236, 363, 369
AluI AGCT 4 cut(s) 150, 236, 363, 369
Alw21I GWGCWC 1 cut(s) 450
Alw26I GTCTC 2 cut(s) 169, 343
Ama87I CYCGRG 1 cut(s) 346
AoxI GGCC 2 cut(s) 73, 308
ApoI RAATTY 1 cut(s) 178
AspS9I GGNCC 1 cut(s) 240
AsuHPI GGTGA 1 cut(s) 425
AvaI CYCGRG 1 cut(s) 346
AvaII GGWCC 1 cut(s) 240
Bbv12I GWGCWC 1 cut(s) 450
BccI CCATC 2 cut(s) 194, 319
BcoDI GTCTC 2 cut(s) 169, 343
BfaI CTAG 2 cut(s) 56, 487
Bme18I GGWCC 1 cut(s) 240
BmeT110I CYCGRG 1 cut(s) 346
BmgT120I GGNCC 1 cut(s) 240
BmiI GGNNCC 2 cut(s) 241, 408
BmsI GCATC 2 cut(s) 95, 454
BplI GAGNNNNNCTC 2 cut(s) 432, 464
BpuEI CTTGAG 1 cut(s) 130
BsaI GGTCTC 2 cut(s) 169, 343
BsaJI CCNNGG 2 cut(s) 159, 353
BseDI CCNNGG 2 cut(s) 159, 353
BseGI GGATG 3 cut(s) 37, 167, 469
BseMII CTCAG 2 cut(s) 107, 341
BseRI GAGGAG 1 cut(s) 420
BseYI CCCAGC 2 cut(s) 135, 236
Bsh1236I CGCG 1 cut(s) 439
BshFI GGCC 2 cut(s) 75, 310
BsiHKAI GWGCWC 1 cut(s) 450
BsiHKCI CYCGRG 1 cut(s) 346
BslFI GGGAC 1 cut(s) 253
BsmAI GTCTC 2 cut(s) 169, 343
BsmFI GGGAC 1 cut(s) 253
BsnI GGCC 2 cut(s) 75, 310
Bso31I GGTCTC 2 cut(s) 169, 343
BsoBI CYCGRG 1 cut(s) 346
Bsp1286I GDGCHC 1 cut(s) 450
Bsp19I CCATGG 1 cut(s) 353
BspACI CCGC 2 cut(s) 274, 437
BspANI GGCC 2 cut(s) 75, 310
BspCNI CTCAG 2 cut(s) 106, 340
BspFNI CGCG 1 cut(s) 439
BspLI GGNNCC 2 cut(s) 241, 408
BspTNI GGTCTC 2 cut(s) 169, 343
BsrBI CCGCTC 1 cut(s) 274
BssECI CCNNGG 2 cut(s) 159, 353
BssT1I CCWWGG 2 cut(s) 159, 353
BstDEI CTNAG 2 cut(s) 93, 327
BstDSI CCRYGG 1 cut(s) 353
BstF5I GGATG 3 cut(s) 37, 167, 469
BstFNI CGCG 1 cut(s) 439
BstMAI GTCTC 2 cut(s) 169, 343
BstMWI GCNNNNNNNGC 1 cut(s) 445
BstUI CGCG 1 cut(s) 439
BstXI CCANNNNNNTGG 1 cut(s) 225
BsuRI GGCC 2 cut(s) 75, 310
BtgI CCRYGG 1 cut(s) 353
BtsCI GGATG 3 cut(s) 37, 167, 469
BtsI GCAGTG 1 cut(s) 258
BtsIMutI CAGTG 1 cut(s) 258
Cfr13I GGNCC 1 cut(s) 240
CviAII CATG 2 cut(s) 47, 354
DdeI CTNAG 2 cut(s) 93, 327
DrdI GACNNNNNNGTC 1 cut(s) 328
DseDI GACNNNNNNGTC 1 cut(s) 328
Eco130I CCWWGG 2 cut(s) 159, 353
Eco31I GGTCTC 2 cut(s) 169, 343
Eco47I GGWCC 1 cut(s) 240
Eco88I CYCGRG 1 cut(s) 346
EcoT14I CCWWGG 2 cut(s) 159, 353
EcoT22I ATGCAT 1 cut(s) 88
ErhI CCWWGG 2 cut(s) 159, 353
FaeI CATG 2 cut(s) 50, 357
FaiI YATR 4 cut(s) 25, 48, 84, 355
FaqI GGGAC 1 cut(s) 253
FatI CATG 2 cut(s) 46, 353
FauI CCCGC 1 cut(s) 444
FokI GGATG 3 cut(s) 44, 154, 476
FspBI CTAG 2 cut(s) 56, 487
GsaI CCCAGC 2 cut(s) 139, 240
HaeIII GGCC 2 cut(s) 75, 310
Hin1II CATG 2 cut(s) 50, 357
HindIII AAGCTT 1 cut(s) 361
HphI GGTGA 1 cut(s) 425
Hpy188I TCNGA 1 cut(s) 411
Hpy188III TCNNGA 1 cut(s) 29
Hpy99I CGWCG 2 cut(s) 301, 304
HpyAV CCTTC 2 cut(s) 65, 274
HpyCH4V TGCA 2 cut(s) 86, 467
HpyF10VI GCNNNNNNNGC 1 cut(s) 445
HpyF3I CTNAG 2 cut(s) 93, 327
Hsp92II CATG 2 cut(s) 50, 357
LpnPI CCDG 4 cut(s) 14, 149, 195, 222
LweI GCATC 2 cut(s) 95, 454
MaeI CTAG 2 cut(s) 56, 487
MaeIII GTNAC 1 cut(s) 398
MbiI CCGCTC 1 cut(s) 274
MboII GAAGA 2 cut(s) 81, 289
MhlI GDGCHC 1 cut(s) 450
MluCI AATT 1 cut(s) 178
MmeI TCCRAC 1 cut(s) 441
MnlI CCTC 8 cut(s) 35, 150, 216, 240, 300, 304, 400, 441
Mph1103I ATGCAT 1 cut(s) 88
MspA1I CMGCKG 1 cut(s) 236
MvnI CGCG 1 cut(s) 439
MwoI GCNNNNNNNGC 1 cut(s) 445
NcoI CCATGG 1 cut(s) 353
NlaIII CATG 2 cut(s) 50, 357
NlaIV GGNNCC 2 cut(s) 241, 408
NmuCI GTSAC 1 cut(s) 398
NsiI ATGCAT 1 cut(s) 88
PspFI CCCAGC 2 cut(s) 135, 236
PspN4I GGNNCC 2 cut(s) 241, 408
PspPI GGNCC 1 cut(s) 240
PvuII CAGCTG 1 cut(s) 236
Sau96I GGNCC 1 cut(s) 240
SduI GDGCHC 1 cut(s) 450
SetI ASST 9 cut(s) 61, 118, 152, 165, 227, 238, 365, 371, 408
SfaNI GCATC 2 cut(s) 95, 454
SinI GGWCC 1 cut(s) 240
SmlI CTYRAG 1 cut(s) 145
SmoI CTYRAG 1 cut(s) 145
Sse9I AATT 1 cut(s) 178
SsiI CCGC 2 cut(s) 274, 437
SspMI CTAG 2 cut(s) 56, 487
StyI CCWWGG 2 cut(s) 159, 353
TaqI TCGA 3 cut(s) 270, 302, 450
TasI AATT 1 cut(s) 178
TscAI CASTG 1 cut(s) 265
TseFI GTSAC 1 cut(s) 398
Tsp45I GTSAC 1 cut(s) 398
TspDTI ATGAA 2 cut(s) 63, 93
TspGWI ACGGA 1 cut(s) 447
TspRI CASTG 1 cut(s) 265
VpaK11BI GGWCC 1 cut(s) 240
XapI RAATTY 1 cut(s) 178
XspI CTAG 2 cut(s) 56, 487
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.