Rroxscaffold_2G00122930

Belongs to the adaptor complexes medium subunit family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
56368640 .. 56369794
1155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00122930.1

Sequence Viewer

Length: 168 bp
ATGGCTAAAAGAATGCCTGTGACAACTATCACAAAATCTGTTGTAGCTAATGAGCGTGGGGGTAGGAAGAGAGAGGAGATTTTTGTGGACAAAATTGAGAATCCGGGTGTCACATTCGGTTCCGGTGGGTATATACTTATTTCGAAATTGATGGTACTATTCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.1

Weight (kDa)

9.99

Isoelectric Point (pI)

49.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 156
AgsI TTSAA 1 cut(s) 163
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AsuC2I CCSGG 1 cut(s) 105
AsuII TTCGAA 1 cut(s) 143
BccI CCATC 1 cut(s) 145
BcnI CCSGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 105
Bpu14I TTCGAA 1 cut(s) 143
BpuMI CCSGG 1 cut(s) 105
BsaWI WCCGGW 1 cut(s) 122
BseRI GAGGAG 1 cut(s) 89
BsiSI CCGG 2 cut(s) 104, 123
BsmI GAATGC 1 cut(s) 18
Bsp119I TTCGAA 1 cut(s) 143
BspLI GGNNCC 1 cut(s) 121
BspT104I TTCGAA 1 cut(s) 143
Bst6I CTCTTC 1 cut(s) 62
BstBI TTCGAA 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 103
Csp6I GTAC 1 cut(s) 155
CviJI RGCY 2 cut(s) 5, 47
CviKI_1 RGCY 2 cut(s) 5, 47
CviQI GTAC 1 cut(s) 155
Eam1104I CTCTTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 62
FaiI YATR 2 cut(s) 132, 134
HapII CCGG 2 cut(s) 104, 123
HinfI GANTC 1 cut(s) 100
HpaII CCGG 2 cut(s) 104, 123
Hpy166II GTNNAC 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 88
LpnPI CCDG 3 cut(s) 30, 117, 136
MaeIII GTNAC 2 cut(s) 19, 109
MboII GAAGA 1 cut(s) 79
MfeI CAATTG 1 cut(s) 163
MluCI AATT 3 cut(s) 93, 146, 163
MnlI CCTC 1 cut(s) 67
MspI CCGG 2 cut(s) 104, 123
MspR9I CCNGG 1 cut(s) 105
MunI CAATTG 1 cut(s) 163
Mva1269I GAATGC 1 cut(s) 18
NciI CCSGG 1 cut(s) 105
NlaIV GGNNCC 1 cut(s) 121
NmuCI GTSAC 2 cut(s) 19, 109
NspV TTCGAA 1 cut(s) 143
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 100
PspN4I GGNNCC 1 cut(s) 121
RsaI GTAC 1 cut(s) 156
RsaNI GTAC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 105
SetI ASST 1 cut(s) 49
SfuI TTCGAA 1 cut(s) 143
SgeI CNNG 5 cut(s) 29, 68, 116, 117, 135
Sse9I AATT 3 cut(s) 93, 146, 163
StyD4I CCNGG 1 cut(s) 103
TaqI TCGA 1 cut(s) 143
TasI AATT 3 cut(s) 93, 146, 163
TfiI GAWTC 1 cut(s) 100
TseFI GTSAC 2 cut(s) 19, 109
Tsp45I GTSAC 2 cut(s) 19, 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.