Rroxscaffold_3G00235500

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
22525653 .. 22527639
1987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00235500.1

Sequence Viewer

Length: 150 bp
ATGAGCTTGTCTTTTAGACAATTGCCTCTTTTCTTGCTTAGGATACCTGCTACTCCTGTACTTGTTTGTTTTTTCACTATCATTGTAAGAGCTGTTTACATTCAGATCCGAGATTTTGTACTTATTGGCGTTCCCATGCAAGGGATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.61

Weight (kDa)

10.69

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 55
AclWI GGATC 1 cut(s) 100
AfaI GTAC 2 cut(s) 60, 120
AfiI CCNNNNNNNGG 2 cut(s) 140, 141
AluBI AGCT 2 cut(s) 6, 92
AluI AGCT 2 cut(s) 6, 92
AlwI GGATC 1 cut(s) 100
BciVI GTATCC 1 cut(s) 36
BfuAI ACCTGC 1 cut(s) 55
BfuI GTATCC 1 cut(s) 36
Bpu10I CCTNAGC 1 cut(s) 38
Bsc4I CCNNNNNNNGG 2 cut(s) 140, 141
BseLI CCNNNNNNNGG 2 cut(s) 140, 141
BslI CCNNNNNNNGG 2 cut(s) 140, 141
Bsp143I GATC 1 cut(s) 105
BspMI ACCTGC 1 cut(s) 55
BspPI GGATC 1 cut(s) 100
BssMI GATC 1 cut(s) 105
BstDEI CTNAG 1 cut(s) 38
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
BsuI GTATCC 1 cut(s) 36
BveI ACCTGC 1 cut(s) 55
Csp6I GTAC 2 cut(s) 59, 119
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 6, 92
CviKI_1 RGCY 2 cut(s) 6, 92
CviQI GTAC 2 cut(s) 59, 119
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
FaeI CATG 1 cut(s) 139
FaiI YATR 2 cut(s) 137, 148
FatI CATG 1 cut(s) 135
FspEI CC 8 cut(s) 25, 39, 60, 69, 111, 122, 126, 127
Hin1II CATG 1 cut(s) 139
Hpy166II GTNNAC 1 cut(s) 97
Hpy188I TCNGA 2 cut(s) 105, 110
Hpy8I GTNNAC 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 139
HpyF3I CTNAG 1 cut(s) 38
Hsp92II CATG 1 cut(s) 139
Kzo9I GATC 1 cut(s) 105
LpnPI CCDG 2 cut(s) 60, 69
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MfeI CAATTG 1 cut(s) 20
MflI RGATCY 1 cut(s) 105
MluCI AATT 1 cut(s) 20
MnlI CCTC 1 cut(s) 36
MunI CAATTG 1 cut(s) 20
NdeII GATC 1 cut(s) 105
NlaIII CATG 1 cut(s) 139
PsuI RGATCY 1 cut(s) 105
RsaI GTAC 2 cut(s) 60, 120
RsaNI GTAC 2 cut(s) 59, 119
Sau3AI GATC 1 cut(s) 105
SetI ASST 3 cut(s) 8, 49, 94
SgeI CNNG 6 cut(s) 19, 46, 59, 68, 74, 122
Sse9I AATT 1 cut(s) 20
TasI AATT 1 cut(s) 20
TatI WGTACW 2 cut(s) 58, 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.