Rh3CG253700

60s ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0005208
Physical Location & Seq
Reverse (-)
24720541 .. 24723948
3408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG253700.1

Sequence Viewer

Length: 222 bp
ATGAAGCCTGGGAGTACTCGACTGCTTGAGAATCAGATGGATGATGTTCTTATTAAAAAGCTGAAACCGCCGAAAGTGTTCCCACAAGAGAGGAAAGATGATAAGAAGAGTGTGGATGCTTCGTTGATAAAGTCCATTGAGGCTGTCCCAGACTTGAAGACATACTTAGATGCAAGATTCTCTCTTAGGTCTGGCATGAAGCCTCATGAGCTTGTCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L6e Ribosomal_L6e_N

Protein Analysis

73

Amino Acids

8.37

Weight (kDa)

9.52

Isoelectric Point (pI)

22.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L6e PF01159 16 - 73 1.6e-14 Ribosomal protein L6e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 68
AfaI GTAC 1 cut(s) 16
AgsI TTSAA 1 cut(s) 157
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 2 cut(s) 61, 211
AluI AGCT 2 cut(s) 61, 211
Asp700I GAANNNNTTC 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 164
BccI CCATC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 9
BmcAI AGTACT 1 cut(s) 16
Bme1390I CCNGG 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 9
BmsI GCATC 2 cut(s) 106, 160
BpiI GAAGAC 1 cut(s) 164
BpuEI CTTGAG 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 8
BseBI CCWGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 8
BseGI GGATG 2 cut(s) 46, 121
BslFI GGGAC 1 cut(s) 131
BsmFI GGGAC 1 cut(s) 131
BspACI CCGC 1 cut(s) 68
BspHI TCATGA 1 cut(s) 205
BssECI CCNNGG 1 cut(s) 8
Bst2UI CCWGG 1 cut(s) 9
Bst6I CTCTTC 1 cut(s) 101
BstDEI CTNAG 2 cut(s) 166, 185
BstF5I GGATG 2 cut(s) 46, 121
BstMWI GCNNNNNNNGC 2 cut(s) 67, 208
BstNI CCWGG 1 cut(s) 9
BstSCI CCNGG 1 cut(s) 7
BstV2I GAAGAC 1 cut(s) 164
BtsCI GGATG 2 cut(s) 46, 121
CciI TCATGA 1 cut(s) 205
Csp6I GTAC 1 cut(s) 15
CviAII CATG 2 cut(s) 196, 206
CviJI RGCY 5 cut(s) 7, 61, 143, 202, 211
CviKI_1 RGCY 5 cut(s) 7, 61, 143, 202, 211
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 2 cut(s) 166, 185
Eam1104I CTCTTC 1 cut(s) 101
EarI CTCTTC 1 cut(s) 101
EcoRII CCWGG 1 cut(s) 7
FaeI CATG 2 cut(s) 199, 209
FaiI YATR 3 cut(s) 163, 197, 207
FalI AAGNNNNNCTT 2 cut(s) 149, 181
FaqI GGGAC 1 cut(s) 131
FatI CATG 2 cut(s) 195, 205
FokI GGATG 2 cut(s) 53, 128
Hin1II CATG 2 cut(s) 199, 209
HinfI GANTC 2 cut(s) 31, 177
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 173
HpyF10VI GCNNNNNNNGC 2 cut(s) 67, 208
HpyF3I CTNAG 2 cut(s) 166, 185
Hsp92II CATG 2 cut(s) 199, 209
LpnPI CCDG 3 cut(s) 21, 162, 177
LweI GCATC 2 cut(s) 106, 160
MboII GAAGA 2 cut(s) 118, 169
MnlI CCTC 3 cut(s) 84, 133, 213
MroXI GAANNNNTTC 1 cut(s) 77
MseI TTAA 1 cut(s) 54
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
MwoI GCNNNNNNNGC 2 cut(s) 67, 208
NlaIII CATG 2 cut(s) 199, 209
PagI TCATGA 1 cut(s) 205
PdmI GAANNNNTTC 1 cut(s) 77
PfeI GAWTC 2 cut(s) 31, 177
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SaqAI TTAA 1 cut(s) 54
ScaI AGTACT 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 9
SetI ASST 3 cut(s) 63, 191, 213
SfaNI GCATC 2 cut(s) 106, 160
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
SsiI CCGC 1 cut(s) 68
StyD4I CCNGG 1 cut(s) 7
TaqI TCGA 1 cut(s) 19
TatI WGTACW 1 cut(s) 14
TfiI GAWTC 2 cut(s) 31, 177
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspDTI ATGAA 2 cut(s) 17, 212
XmnI GAANNNNTTC 1 cut(s) 77
ZrmI AGTACT 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.