Rroxscaffold_4G00316480

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Forward (+)
41340496 .. 41342817
2322 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316480.1

Sequence Viewer

Length: 156 bp
ATGCCAATCAACTTTGTTATTGATAAGCATTGGGGAAAGCGTAATGAACTCCCAGGATATGTTACTCTTTTAGGCGGAAATAGGATTCCTCTGATCACTATCGGAGGCAAGAAATCTGCGGGGATTGATGCACCTCCTTTGTGCTCCATAGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.44

Weight (kDa)

9.51

Isoelectric Point (pI)

25.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 75, 119
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 1 cut(s) 152
AluI AGCT 1 cut(s) 152
Alw21I GWGCWC 1 cut(s) 146
Bbv12I GWGCWC 1 cut(s) 146
BciT130I CCWGG 1 cut(s) 54
BclI TGATCA 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 118
BsaBI GATNNNNATC 1 cut(s) 98
BsaJI CCNNGG 1 cut(s) 52
Bse8I GATNNNNATC 1 cut(s) 98
BseBI CCWGG 1 cut(s) 54
BseDI CCNNGG 1 cut(s) 52
BseJI GATNNNNATC 1 cut(s) 98
BsiHKAI GWGCWC 1 cut(s) 146
Bsp1286I GDGCHC 1 cut(s) 146
Bsp143I GATC 1 cut(s) 93
BspACI CCGC 2 cut(s) 75, 119
BssECI CCNNGG 1 cut(s) 52
BssMI GATC 1 cut(s) 93
Bst2UI CCWGG 1 cut(s) 54
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
CviJI RGCY 1 cut(s) 152
CviKI_1 RGCY 1 cut(s) 152
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
EciI GGCGGA 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 52
FaiI YATR 2 cut(s) 60, 149
FauI CCCGC 1 cut(s) 112
FbaI TGATCA 1 cut(s) 93
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 2 cut(s) 93, 104
HpyCH4V TGCA 1 cut(s) 131
Ksp22I TGATCA 1 cut(s) 93
Kzo9I GATC 1 cut(s) 93
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 2 cut(s) 39, 66
LweI GCATC 1 cut(s) 118
MaeIII GTNAC 1 cut(s) 61
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 146
MnlI CCTC 3 cut(s) 98, 99, 144
MspR9I CCNGG 1 cut(s) 54
MvaI CCWGG 1 cut(s) 54
NdeII GATC 1 cut(s) 93
PfeI GAWTC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
Sau3AI GATC 1 cut(s) 93
ScrFI CCNGG 1 cut(s) 54
SduI GDGCHC 1 cut(s) 146
SetI ASST 2 cut(s) 136, 154
SfaNI GCATC 1 cut(s) 118
SgeI CNNG 4 cut(s) 65, 66, 121, 132
SsiI CCGC 2 cut(s) 75, 119
StyD4I CCNGG 1 cut(s) 52
TfiI GAWTC 1 cut(s) 85
TspDTI ATGAA 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.