Rh1CG321700

60s ribosomal protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0005208
Physical Location & Seq
Reverse (-)
59665299 .. 59696387
31089 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG321700.1

Sequence Viewer

Length: 249 bp
ATGAGACAAGAAAGTGTTCCCACAAGAGAGGAAGATGATCAGAAGAGTGCGGATGCTTCGTTGATAAAGTCCATTGAGGCTGTCCCAGACTTGAAGACATACTTAGTTGCAAGATTCTCTCTTAGGTCTGACATACTTAGGATACTTGTTCCCGTTCTTGTTTGTTTCTTTACTACGATTGTATGTTCTGTTCACATTGAGATCCGAGATTTTGTACTGATCGGCATTGCCTTGCAAGGGATGTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L6e Ribosomal_L6e_N

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

5.21

Isoelectric Point (pI)

61.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L6e PF01159 3 - 44 6.3e-07 Ribosomal protein L6e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 50
AclWI GGATC 1 cut(s) 196
AfaI GTAC 1 cut(s) 216
AfiI CCNNNNNNNGG 1 cut(s) 237
AgsI TTSAA 1 cut(s) 94
AlwI GGATC 1 cut(s) 196
Asp700I GAANNNNTTC 1 cut(s) 15
BbsI GAAGAC 1 cut(s) 101
BciVI GTATCC 1 cut(s) 135
BclI TGATCA 1 cut(s) 37
BfuI GTATCC 1 cut(s) 135
BmsI GCATC 1 cut(s) 43
BpiI GAAGAC 1 cut(s) 101
Bsc4I CCNNNNNNNGG 1 cut(s) 237
Bse3DI GCAATG 1 cut(s) 225
BseGI GGATG 2 cut(s) 58, 246
BseLI CCNNNNNNNGG 1 cut(s) 237
BseMI GCAATG 1 cut(s) 225
BslFI GGGAC 1 cut(s) 68
BslI CCNNNNNNNGG 1 cut(s) 237
BsmFI GGGAC 1 cut(s) 68
Bsp143I GATC 3 cut(s) 37, 201, 219
BspACI CCGC 1 cut(s) 50
BspPI GGATC 1 cut(s) 196
BsrDI GCAATG 1 cut(s) 225
BssMI GATC 3 cut(s) 37, 201, 219
Bst6I CTCTTC 1 cut(s) 38
BstDEI CTNAG 3 cut(s) 103, 122, 137
BstF5I GGATG 2 cut(s) 58, 246
BstKTI GATC 3 cut(s) 40, 204, 222
BstMBI GATC 3 cut(s) 37, 201, 219
BstV2I GAAGAC 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 201
BstYI RGATCY 1 cut(s) 201
BsuI GTATCC 1 cut(s) 135
BtsCI GGATG 2 cut(s) 58, 246
Csp6I GTAC 1 cut(s) 215
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
CviQI GTAC 1 cut(s) 215
DdeI CTNAG 3 cut(s) 103, 122, 137
DpnI GATC 3 cut(s) 39, 203, 221
DpnII GATC 3 cut(s) 37, 201, 219
Eam1104I CTCTTC 1 cut(s) 38
EarI CTCTTC 1 cut(s) 38
FaiI YATR 4 cut(s) 100, 134, 184, 247
FalI AAGNNNNNCTT 2 cut(s) 86, 118
FaqI GGGAC 1 cut(s) 68
FbaI TGATCA 1 cut(s) 37
FokI GGATG 1 cut(s) 65
HinfI GANTC 1 cut(s) 114
Hpy166II GTNNAC 1 cut(s) 193
Hpy188I TCNGA 3 cut(s) 42, 130, 206
Hpy8I GTNNAC 1 cut(s) 193
HpyCH4V TGCA 2 cut(s) 110, 235
HpyF3I CTNAG 3 cut(s) 103, 122, 137
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 37, 201, 219
LpnPI CCDG 1 cut(s) 99
LweI GCATC 1 cut(s) 43
MalI GATC 3 cut(s) 39, 203, 221
MboI GATC 3 cut(s) 37, 201, 219
MboII GAAGA 3 cut(s) 44, 55, 106
MflI RGATCY 1 cut(s) 201
MnlI CCTC 2 cut(s) 22, 70
MroXI GAANNNNTTC 1 cut(s) 15
NdeII GATC 3 cut(s) 37, 201, 219
PdmI GAANNNNTTC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 114
PsrI GAACNNNNNNTAC 2 cut(s) 174, 206
PsuI RGATCY 1 cut(s) 201
RsaI GTAC 1 cut(s) 216
RsaNI GTAC 1 cut(s) 215
Sau3AI GATC 3 cut(s) 37, 201, 219
SetI ASST 1 cut(s) 128
SfaNI GCATC 1 cut(s) 43
SsiI CCGC 1 cut(s) 50
TatI WGTACW 1 cut(s) 214
TfiI GAWTC 1 cut(s) 114
XmnI GAANNNNTTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.