Rroxscaffold_6G00420950

Belongs to the actin-binding proteins ADF family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
42157968 .. 42160650
2683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00420950.1

Sequence Viewer

Length: 477 bp
ATGTTGAATACTGTGCTTGATGTCTTCAATTCTTCTTCTGTGGATGGAAAGATCAGAACACTCCATCAATGCCAGGCTCGACTACAACAGCTTTTGAATGGAAACCATTCCCGGAAGCTTGAAGAAAAGTTGGCAGAACAGGGGAATATTGCAGGATTATATCAGCAGAAAGCTGGAGTGGCTGATGAAGGAATGGTTGATGAAGGAATGGTTGATGAAGGAGTGGCTTATGCACAAGTTGCTGATGCTTTGACCCTATTGCAAAATAACTATAATGGAGAAGAAGAATTGGAGATAGGTGATGGCTTAACCAATATTTTCAAAACTTATGCAGAGGCCGATGCAACATCTGGTATTGCTATGCACAATGAGTGCAAGTTGAAGTTTCTGGAGCTCAAGACAAAGAGGACCTACCGTTCAATAGTCTTCAAGATTGAGGAGAAGCAAAAAGCAAGTTATTGTGGAAGCAACTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

158

Amino Acids

17.58

Weight (kDa)

5.11

Isoelectric Point (pI)

36.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 8 cut(s) 7, 28, 97, 122, 322, 382, 420, 430
AjnI CCWGG 1 cut(s) 72
AloI GAACNNNNNNTCC 2 cut(s) 400, 432
AluBI AGCT 4 cut(s) 91, 118, 173, 394
AluI AGCT 4 cut(s) 91, 118, 173, 394
Alw21I GWGCWC 1 cut(s) 396
AoxI GGCC 1 cut(s) 336
Asp700I GAANNNNTTC 1 cut(s) 106
AspS9I GGNCC 1 cut(s) 408
AsuC2I CCSGG 1 cut(s) 112
AsuHPI GGTGA 1 cut(s) 311
AvaII GGWCC 1 cut(s) 408
BanII GRGCYC 1 cut(s) 396
BbsI GAAGAC 2 cut(s) 16, 418
Bbv12I GWGCWC 1 cut(s) 396
BccI CCATC 3 cut(s) 38, 72, 296
BciT130I CCWGG 1 cut(s) 74
BcnI CCSGG 1 cut(s) 112
Bme1390I CCNGG 2 cut(s) 74, 112
Bme18I GGWCC 1 cut(s) 408
BmgT120I GGNCC 1 cut(s) 408
BmrFI CCNGG 2 cut(s) 74, 112
BmsI GCATC 2 cut(s) 235, 331
BpiI GAAGAC 2 cut(s) 16, 418
BpmI CTGGAG 2 cut(s) 195, 410
BpuEI CTTGAG 1 cut(s) 380
BpuMI CCSGG 1 cut(s) 112
Bse1I ACTGG 1 cut(s) 476
BseBI CCWGG 1 cut(s) 74
BseGI GGATG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 476
BseRI GAGGAG 1 cut(s) 452
BshFI GGCC 1 cut(s) 338
BsiHKAI GWGCWC 1 cut(s) 396
BsiSI CCGG 1 cut(s) 112
BsnI GGCC 1 cut(s) 338
Bsp1286I GDGCHC 1 cut(s) 396
Bsp143I GATC 1 cut(s) 51
BspANI GGCC 1 cut(s) 338
BsrI ACTGG 1 cut(s) 476
BssMI GATC 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 74
Bst4CI ACNGT 2 cut(s) 13, 416
BstAPI GCANNNNNTGC 1 cut(s) 239
BstF5I GGATG 1 cut(s) 49
BstKTI GATC 1 cut(s) 54
BstMBI GATC 1 cut(s) 51
BstMWI GCNNNNNNNGC 2 cut(s) 179, 239
BstNI CCWGG 1 cut(s) 74
BstSCI CCNGG 2 cut(s) 72, 110
BstV2I GAAGAC 2 cut(s) 16, 418
BsuRI GGCC 1 cut(s) 338
BtsCI GGATG 1 cut(s) 49
Cfr13I GGNCC 1 cut(s) 408
CviJI RGCY 9 cut(s) 77, 91, 118, 173, 182, 227, 306, 338, 394
CviKI_1 RGCY 9 cut(s) 77, 91, 118, 173, 182, 227, 306, 338, 394
DpnI GATC 1 cut(s) 53
DpnII GATC 1 cut(s) 51
Ecl136II GAGCTC 1 cut(s) 394
Eco24I GRGCYC 1 cut(s) 396
Eco47I GGWCC 1 cut(s) 408
Eco53kI GAGCTC 1 cut(s) 394
EcoICRI GAGCTC 1 cut(s) 394
EcoO109I RGGNCCY 1 cut(s) 408
EcoRII CCWGG 1 cut(s) 72
EcoT38I GRGCYC 1 cut(s) 396
FaiI YATR 5 cut(s) 160, 231, 273, 330, 362
FokI GGATG 1 cut(s) 56
FriOI GRGCYC 1 cut(s) 396
GsuI CTGGAG 2 cut(s) 195, 410
HaeIII GGCC 1 cut(s) 338
HapII CCGG 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 116
HpaII CCGG 1 cut(s) 112
HphI GGTGA 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 56
Hpy188III TCNNGA 3 cut(s) 389, 397, 430
HpyAV CCTTC 3 cut(s) 182, 197, 212
HpyCH4III ACNGT 2 cut(s) 13, 416
HpyCH4V TGCA 7 cut(s) 152, 233, 262, 332, 344, 364, 375
HpyF10VI GCNNNNNNNGC 2 cut(s) 179, 239
Kzo9I GATC 1 cut(s) 51
LmnI GCTCC 1 cut(s) 391
LpnPI CCDG 9 cut(s) 59, 86, 125, 125, 138, 159, 336, 374, 457
LweI GCATC 2 cut(s) 235, 331
MalI GATC 1 cut(s) 53
MboI GATC 1 cut(s) 51
MboII GAAGA 7 cut(s) 16, 24, 27, 134, 293, 296, 418
MhlI GDGCHC 1 cut(s) 396
MluCI AATT 2 cut(s) 28, 287
MnlI CCTC 3 cut(s) 328, 399, 430
MroXI GAANNNNTTC 1 cut(s) 106
MseI TTAA 1 cut(s) 308
MspI CCGG 1 cut(s) 112
MspR9I CCNGG 2 cut(s) 74, 112
MvaI CCWGG 1 cut(s) 74
MwoI GCNNNNNNNGC 2 cut(s) 179, 239
NciI CCSGG 1 cut(s) 112
NdeII GATC 1 cut(s) 51
PdmI GAANNNNTTC 1 cut(s) 106
PfoI TCCNGGA 1 cut(s) 110
PpuMI RGGWCCY 1 cut(s) 408
Psp124BI GAGCTC 1 cut(s) 396
Psp5II RGGWCCY 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 72
PspGI CCWGG 1 cut(s) 72
PspPI GGNCC 1 cut(s) 408
PspPPI RGGWCCY 1 cut(s) 408
SacI GAGCTC 1 cut(s) 396
SaqAI TTAA 1 cut(s) 308
Sau3AI GATC 1 cut(s) 51
Sau96I GGNCC 1 cut(s) 408
ScrFI CCNGG 2 cut(s) 74, 112
SduI GDGCHC 1 cut(s) 396
SetI ASST 6 cut(s) 93, 120, 175, 301, 396, 413
SfaNI GCATC 2 cut(s) 235, 331
SinI GGWCC 1 cut(s) 408
SmlI CTYRAG 1 cut(s) 395
SmoI CTYRAG 1 cut(s) 395
Sse9I AATT 2 cut(s) 28, 287
SspI AATATT 2 cut(s) 148, 316
SstI GAGCTC 1 cut(s) 396
StyD4I CCNGG 2 cut(s) 72, 110
TaaI ACNGT 2 cut(s) 13, 416
TaqI TCGA 1 cut(s) 79
TasI AATT 2 cut(s) 28, 287
Tru1I TTAA 1 cut(s) 308
Tru9I TTAA 1 cut(s) 308
TspDTI ATGAA 3 cut(s) 201, 216, 231
VpaK11BI GGWCC 1 cut(s) 408
XmnI GAANNNNTTC 1 cut(s) 106
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.